Incidental Mutation 'Z1191:Lama1'
ID 667392
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Name laminin, alpha 1
Synonyms Lama
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # Z1191 ()
Quality Score 85.0076
Status Not validated
Chromosome 17
Chromosomal Location 67697265-67822645 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67798644 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2049 (D2049G)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: D2049G

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 444 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik T A 11: 65,152,968 Q89L unknown Het
1700086D15Rik A C 11: 65,152,983 V84G unknown Het
1700086D15Rik A G 11: 65,153,254 F38S unknown Het
1700086D15Rik A G 11: 65,153,288 W27R unknown Het
1700086D15Rik A G 11: 65,153,302 L22P unknown Het
1810065E05Rik C T 11: 58,422,201 L27F probably benign Het
1810065E05Rik C T 11: 58,422,234 L38F possibly damaging Het
1810065E05Rik C T 11: 58,425,799 L202F probably benign Het
2210407C18Rik G A 11: 58,608,509 P161L probably benign Het
2210407C18Rik A G 11: 58,612,561 L47P probably benign Het
2210407C18Rik T G 11: 58,612,571 S44R probably benign Het
2810021J22Rik C T 11: 58,880,535 A281V probably benign Het
4930438A08Rik A G 11: 58,294,018 T521A unknown Het
4931406P16Rik C T 7: 34,239,108 V1001M probably benign Het
4931406P16Rik G A 7: 34,239,158 A984V probably benign Het
4931406P16Rik C T 7: 34,245,760 R565K probably benign Het
4933427D14Rik G A 11: 72,176,709 T585I possibly damaging Het
4933427D14Rik G T 11: 72,189,616 P408H probably damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,195,712 probably null Het
4933427D14Rik A G 11: 72,195,743 C281R possibly damaging Het
4933427D14Rik T G 11: 72,195,754 K277T probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,195,764 probably null Het
4933427D14Rik T C 11: 72,195,769 Q272R probably damaging Het
4933427D14Rik G A 11: 72,198,482 P192L probably benign Het
4933427D14Rik C A 11: 72,198,534 A175S probably benign Het
4933427D14Rik T G 11: 72,198,924 S45R probably damaging Het
Adgrf5 C A 17: 43,445,035 A628E probably benign Het
Akap10 T A 11: 61,915,270 S211C probably benign Het
Alox8 C T 11: 69,186,047 R536Q probably benign Het
Alox8 A G 11: 69,197,496 V76A probably benign Het
Aloxe3 A G 11: 69,128,675 Q138R probably benign Het
Aloxe3 C T 11: 69,148,603 A667V probably benign Het
Arhgap21 C T 2: 20,881,472 R308K probably benign Het
Arih1 T C 9: 59,486,322 Y9C unknown Het
Asb9 A C X: 164,539,664 *291Y probably null Het
Aspa G T 11: 73,322,187 L110I probably benign Het
Atoh1 C A 6: 64,729,380 H20N probably benign Het
Aurkb C T 11: 69,047,866 R44W probably damaging Het
Aurkb T C 11: 69,047,870 F45S probably benign Het
B9d1 A T 11: 61,505,203 probably benign Het
Borcs6 G A 11: 69,060,627 R277Q possibly damaging Het
Btnl10 T C 11: 58,919,312 V93A probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,923,927 probably benign Het
Btnl10 AGAC AGACGAC 11: 58,923,929 probably benign Het
Btnl10 C T 11: 58,926,824 T250I unknown Het
Car10 G T 11: 93,304,636 G90W probably damaging Het
Ccdc42 C T 11: 68,587,191 probably benign Het
Ccdc92b A G 11: 74,630,054 M61V possibly damaging Het
Ccdc93 T G 1: 121,476,068 L309V probably benign Het
Celsr2 C T 3: 108,414,549 G316S possibly damaging Het
Chd3 C A 11: 69,348,445 E1753D probably benign Het
Chd3 A G 11: 69,361,451 W42R probably benign Het
Chl1 T C 6: 103,683,211 L350S probably damaging Het
Chrna7 G A 7: 63,106,193 P202S probably benign Het
Chst8 C T 7: 34,748,181 R4Q probably damaging Het
Cluh CC CCACGAGC 11: 74,669,514 probably benign Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,669,517 probably benign Het
Cluh TGAGCC TGAGCCCGAGCC 11: 74,669,523 probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,526 probably benign Het
Cluh GAGCC GAGCCTAAGCC 11: 74,669,530 probably benign Het
Cntrob C T 11: 69,305,578 R677H probably benign Het
Cntrob G A 11: 69,308,056 P622L probably benign Het
Cyb5d1 A G 11: 69,395,202 L31P probably benign Het
Cyb5d1 C A 11: 69,395,272 A8S probably benign Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnah9 G A 11: 66,147,381 H110Y probably benign Het
Elac2 T C 11: 64,979,189 S27P probably benign Het
Epn2 C A 11: 61,579,634 probably benign Het
Fam114a2 A G 11: 57,484,032 S494P probably benign Het
Fam114a2 G A 11: 57,490,114 A438V probably benign Het
Fam114a2 C T 11: 57,499,755 V318I probably benign Het
Fam114a2 T C 11: 57,499,797 N304D probably benign Het
Fam114a2 C T 11: 57,514,234 G14E probably benign Het
Fam83g G A 11: 61,703,194 R518Q probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,308,970 probably null Het
Fat2 T G 11: 55,309,799 K816N probably benign Het
Fbxw10 G C 11: 62,847,292 R4T probably benign Het
Fbxw10 G A 11: 62,876,845 V836I probably benign Het
Foxl2 G C 9: 98,956,069 G137R probably damaging Het
Gabrg2 T C 11: 41,916,277 I378V probably benign Het
Galnt10 G A 11: 57,765,688 V233I probably benign Het
Gcn1l1 C T 5: 115,575,293 P105L possibly damaging Het
Gemin5 C G 11: 58,122,289 S1446T probably benign Het
Gemin5 T C 11: 58,125,218 S1321G probably benign Het
Gemin5 T C 11: 58,130,071 M1097V probably benign Het
Gemin5 C G 11: 58,139,510 A830P probably benign Het
Gemin5 C G 11: 58,139,575 C808S probably benign Het
Gemin5 C G 11: 58,146,519 E623D probably benign Het
Gjc2 T C 11: 59,176,433 S408G unknown Het
Gjc2 A G,T 11: 59,176,492 V388E unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,182,735 probably benign Het
Glp2r C A 11: 67,709,568 R485L probably damaging Het
Glp2r C A 11: 67,709,644 V460F probably benign Het
Glp2r C G 11: 67,709,646 G459A probably benign Het
Glp2r C T 11: 67,740,167 V295I probably benign Het
Glp2r A G 11: 67,741,052 V283A probably benign Het
Glp2r T C 11: 67,741,059 I281V probably benign Het
Glp2r T C 11: 67,742,303 T235A probably benign Het
Glp2r A G 11: 67,744,947 V189A probably benign Het
Glp2r C A 11: 67,770,836 A13S probably benign Het
Gm12253 G C 11: 58,434,541 S13T possibly damaging Het
Gm12253 A G 11: 58,434,832 E43G probably benign Het
Gm12253 A C 11: 58,434,860 E52D probably benign Het
Gm12253 A C 11: 58,435,411 E84A probably benign Het
Gm12253 G A 11: 58,435,483 S108N probably benign Het
Gm12253 G A 11: 58,441,009 A215T possibly damaging Het
Gm12258 T G 11: 58,858,300 S100R Het
Gm12258 C T 11: 58,858,436 R146W Het
Gm12258 G A 11: 58,858,938 R313H unknown Het
Gm12258 G A 11: 58,858,950 G317E unknown Het
Gm12258 A T 11: 58,859,007 E336V unknown Het
Gm12258 A G 11: 58,859,187 probably benign Het
Gm12258 T A 11: 58,859,188 probably benign Het
Gm12258 G C 11: 58,859,864 G622R unknown Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm6096 G A 7: 34,251,386 A117T possibly damaging Het
Gm6096 G A 7: 34,251,392 V119I possibly damaging Het
Gpatch1 C T 7: 35,281,372 G908R unknown Het
Gpatch1 C T 7: 35,297,654 R373Q possibly damaging Het
Gpatch1 G C 7: 35,318,345 D23E probably benign Het
Gpi1 T C 7: 34,227,237 N95D probably benign Het
Gps2 C T 11: 69,916,304 A60V probably benign Het
Grxcr1 G T 5: 68,166,189 C270F probably damaging Het
Gucy2e C A 11: 69,223,605 A1033S probably benign Het
Gucy2e C G 11: 69,236,603 G15R unknown Het
Guk1 G A 11: 59,191,921 probably benign Het
Haspin T C 11: 73,137,348 Q305R probably benign Het
Haspin A G 11: 73,137,951 L104P probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hic1 G A 11: 75,167,526 T179M probably damaging Het
Hic1 GGGGGAGGGGA GGGGGA 11: 75,169,448 probably null Het
Hic1 GGGGAGGG GGGG 11: 75,169,449 probably null Het
Hic1 GGGAGG GGG 11: 75,169,450 probably benign Het
Iba57 CAGA CAGAGA 11: 59,161,503 probably null Het
Iba57 A AGC 11: 59,161,506 probably null Het
Iba57 T C 11: 59,161,555 T87A unknown Het
Iba57 T C 11: 59,161,558 T86A unknown Het
Iba57 C G 11: 59,163,039 G36R unknown Het
Igf1r AGGAGCTGGAGATGGAGC AGGAGCTGGAGATGGAGCTGGAGATGGAGC 7: 68,226,169 probably benign Het
Igf1r GGAGCTGGAGAT GGAGCTGGAGATCGAGCTGGAGAT 7: 68,226,170 probably benign Het
Igf1r GCTGGAGATGGA GCTGGAGATGGACCTGGAGATGGA 7: 68,226,173 probably benign Het
Igtp T G 11: 58,206,343 D113E probably damaging Het
Igtp C G 11: 58,206,965 L321V possibly damaging Het
Igtp C G 11: 58,207,118 L372V probably benign Het
Il2rg A G X: 101,265,381 F307L probably damaging Het
Inpp5d C G 1: 87,683,770 Q315E probably benign Het
Irgm2 T A 11: 58,219,513 V10D probably benign Het
Irgm2 A G 11: 58,219,563 N27D probably benign Het
Irgm2 T C 11: 58,219,912 I143T probably benign Het
Irgm2 T C 11: 58,219,954 L157S probably benign Het
Irgm2 G A 11: 58,220,007 V175I probably benign Het
Irgm2 G A 11: 58,220,098 S205N probably benign Het
Irgm2 A C 11: 58,220,125 H214P probably benign Het
Irgm2 G T 11: 58,220,412 A310S possibly damaging Het
Irgm2 C G 11: 58,220,563 T360S probably benign Het
Itgae T A 11: 73,103,887 L22M possibly damaging Het
Itgae A T 11: 73,103,960 Q46L probably damaging Het
Itgae A G 11: 73,115,640 H378R probably benign Het
Itgae G A 11: 73,118,087 V465I probably benign Het
Itgae A T 11: 73,121,931 K696N probably benign Het
Itgae G T 11: 73,121,957 G705V probably benign Het
Itgae C G 11: 73,134,127 S1028W probably benign Het
Kif1c C T 11: 70,724,114 P578L probably benign Het
Krt26 C T 11: 99,337,817 G30R probably damaging Het
Larp1 G A 11: 58,042,340 V257I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,713,097 probably null Het
Lypd8 T C 11: 58,382,775 Y27H probably benign Het
Lypd8 C A 11: 58,384,649 A70E possibly damaging Het
Lypd8 G A 11: 58,384,663 E75K probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,390,233 probably benign Het
Malrd1 G A 2: 16,042,226 S1721N unknown Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,490,212 probably benign Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,490,227 probably benign Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mfap3 A T 11: 57,528,040 I9F possibly damaging Het
Mfap3 G A 11: 57,528,076 G21S probably benign Het
Mrpl22 G A 11: 58,171,695 A4T unknown Het
Mrpl55 A G 11: 59,204,173 probably null Het
Mrpl55 A T 11: 59,204,589 L26F probably benign Het
Myh1 A C 11: 67,204,446 T211P probably benign Het
Myh8 A C 11: 67,297,486 N991T probably benign Het
Myo6 G T 9: 80,242,227 E152* probably null Het
Myocd A G 11: 65,184,592 S697P probably benign Het
Nlgn2 A G 11: 69,828,394 V210A possibly damaging Het
Nlrp1a T C 11: 71,092,243 K1299R probably benign Het
Nlrp1a C T 11: 71,097,251 R1131Q probably damaging Het
Nlrp1a T C 11: 71,099,616 I1038V probably benign Het
Nlrp1a T C 11: 71,124,088 E112G probably benign Het
Nlrp1a C G 11: 71,142,529 probably null Het
Nlrp1b C A 11: 71,181,708 M436I probably benign Het
Nlrp1b A C 11: 71,181,713 S435A probably benign Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Nlrp1b G C 11: 71,182,309 T236R probably benign Het
Nlrp1b A G 11: 71,182,322 Y232H probably benign Het
Nlrp1b A T 11: 71,182,440 D192E probably benign Het
Nlrp1b T C 11: 71,182,454 T188A probably benign Het
Nlrp1b C G 11: 71,182,544 E158Q probably benign Het
Nlrp1b A T 11: 71,182,552 M155K probably benign Het
Nlrp1b T A 11: 71,182,570 Q149L probably benign Het
Nlrp1b T C 11: 71,182,677 I113M probably benign Het
Nmur2 T C 11: 56,040,278 I202M probably benign Het
Obscn G A 11: 59,000,889 A6939V probably benign Het
Obscn C G 11: 59,009,193 G938A probably benign Het
Obscn G C 11: 59,013,188 T7320S probably benign Het
Obscn C T 11: 59,031,108 R5954Q probably damaging Het
Obscn G C 11: 59,039,150 P5080A probably benign Het
Obscn T A 11: 59,039,164 Q5075L probably damaging Het
Obscn T C 11: 59,041,775 I4869V probably benign Het
Obscn T A 11: 59,041,848 probably null Het
Obscn T C 11: 59,042,950 T5363A probably benign Het
Obscn G A 11: 59,043,027 A5337V probably benign Het
Obscn G A 11: 59,043,052 R5329C probably benign Het
Obscn C T 11: 59,049,480 D5354N Het
Obscn C A 11: 59,049,788 R4593S possibly damaging Het
Obscn T C 11: 59,049,797 T5307A Het
Obscn G A 11: 59,051,557 T4372M probably benign Het
Obscn T C 11: 59,052,613 M4237V probably benign Het
Obscn C T 11: 59,053,768 R4700Q probably benign Het
Obscn T C 11: 59,053,825 K4681R probably benign Het
Obscn T C 11: 59,054,218 E4658G probably benign Het
Obscn C T 11: 59,054,350 R4614Q probably benign Het
Obscn T C 11: 59,054,834 T4184A probably benign Het
Obscn C T 11: 59,055,457 R4474H probably damaging Het
Obscn T C 11: 59,055,505 D4458G probably damaging Het
Obscn C T 11: 59,055,514 R4455K probably benign Het
Obscn G T 11: 59,056,110 A4066E possibly damaging Het
Obscn A G 11: 59,056,769 M4478T Het
Obscn C A 11: 59,060,997 G3977W probably damaging Het
Obscn C T 11: 59,061,562 G3894R probably benign Het
Obscn C T 11: 59,061,582 R3887K probably benign Het
Obscn G C 11: 59,062,133 P4115A probably benign Het
Obscn C T 11: 59,062,139 D4113N probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Obscn T C 11: 59,063,474 T4037A Het
Obscn T C 11: 59,063,576 K3727E probably damaging Het
Obscn G A 11: 59,067,147 R3576C probably benign Het
Obscn C T 11: 59,067,829 V3433I probably benign Het
Obscn C A 11: 59,069,931 A3185S probably benign Het
Obscn C T 11: 59,076,508 V2792I possibly damaging Het
Obscn G A 11: 59,079,158 R53C probably damaging Het
Obscn C G 11: 59,079,896 V2328L probably benign Het
Obscn C A 11: 59,081,872 G2116V possibly damaging Het
Obscn C T 11: 59,086,679 R1865H probably benign Het
Obscn T C 11: 59,086,701 R1858G probably benign Het
Obscn A G 11: 59,086,739 V1845A probably benign Het
Obscn T C 11: 59,090,747 H1815R probably benign Het
Obscn A G 11: 59,093,316 F1771S probably benign Het
Obscn C T 11: 59,093,413 V1739M possibly damaging Het
Obscn G T 11: 59,093,508 A1707D possibly damaging Het
Obscn C T 11: 59,093,509 A1707T probably benign Het
Obscn G A 11: 59,093,559 A1690V probably benign Het
Obscn C T 11: 59,099,909 A1613T possibly damaging Het
Obscn T C 11: 59,099,929 H1606R probably benign Het
Obscn C G 11: 59,103,341 A1572P probably damaging Het
Obscn T C 11: 59,103,514 H1514R probably benign Het
Obscn G A 11: 59,103,538 A1506V probably benign Het
Obscn T C 11: 59,112,554 E1306G probably benign Het
Obscn T C 11: 59,112,636 M1279V probably benign Het
Obscn T C 11: 59,122,737 M1095V probably benign Het
Obscn A G 11: 59,122,838 V1061A probably benign Het
Obscn C T 11: 59,128,066 A949T probably benign Het
Obscn C T 11: 59,128,069 V973M probably damaging Het
Obscn C T 11: 59,128,249 A888T probably damaging Het
Obscn T C 11: 59,129,687 M844V probably benign Het
Obscn G T 11: 59,129,837 L794M probably benign Het
Obscn C T 11: 59,130,623 R797H probably damaging Het
Obscn C T 11: 59,133,111 A578T possibly damaging Het
Obscn G A 11: 59,133,240 P535S probably damaging Het
Obscn C G 11: 59,133,246 A533P probably benign Het
Obscn T C 11: 59,135,679 I233V probably benign Het
Olfr1080 T C 2: 86,554,127 probably benign Het
Olfr146 T A 9: 39,018,933 S203C probably damaging Het
Olfr224 G A 11: 58,566,562 A261V probably benign Het
Olfr224 A T 11: 58,566,695 S217T probably benign Het
Olfr224 C T 11: 58,567,094 V84I probably benign Het
Olfr311 G C 11: 58,841,081 probably benign Het
Olfr311 G T 11: 58,841,119 A2S probably benign Het
Olfr311 C T 11: 58,841,206 L31F probably benign Het
Olfr311 T C 11: 58,841,258 I48T probably benign Het
Olfr311 G A 11: 58,841,743 A210T probably benign Het
Olfr311 A G 11: 58,841,789 H225R probably benign Het
Olfr313 A G 11: 58,817,061 I18V probably benign Het
Olfr313 T C 11: 58,817,296 V96A probably benign Het
Olfr313 A C 11: 58,817,394 I129L probably benign Het
Olfr313 C G 11: 58,817,417 H136Q probably benign Het
Olfr313 T C 11: 58,817,682 C225R probably benign Het
Olfr313 C G 11: 58,817,818 P270R probably benign Het
Olfr314 A G 11: 58,786,947 T238A probably damaging Het
Olfr316 G A 11: 58,757,967 A101T probably benign Het
Olfr316 C T 11: 58,758,069 L135F probably benign Het
Olfr316 A G 11: 58,758,105 S147G probably benign Het
Olfr316 G A 11: 58,758,327 V221M probably damaging Het
Olfr316 A C 11: 58,758,342 I226L probably benign Het
Olfr316 A C 11: 58,758,360 K232Q probably benign Het
Olfr317 T G 11: 58,732,374 N264H probably benign Het
Olfr317 G A 11: 58,732,469 A232V probably benign Het
Olfr317 T C 11: 58,732,649 H172R probably benign Het
Olfr317 C A 11: 58,733,222 probably benign Het
Olfr318 G A 11: 58,721,096 probably benign Het
Olfr319 A C 11: 58,701,958 I86L probably benign Het
Olfr319 C T 11: 58,702,327 L209F possibly damaging Het
Olfr319 C A 11: 58,702,396 Q232K probably benign Het
Olfr320 G T 11: 58,683,932 D20Y probably benign Het
Olfr320 T C 11: 58,683,989 F39L probably benign Het
Olfr320 G A 11: 58,684,115 V81M probably benign Het
Olfr320 G A 11: 58,684,257 R128Q probably benign Het
Olfr320 C T 11: 58,684,463 H197Y probably benign Het
Olfr320 G A 11: 58,684,715 V281I probably benign Het
Olfr320 T C 11: 58,684,722 L283P probably benign Het
Olfr322 T G 11: 58,666,516 I319R probably benign Het
Olfr323 G A 11: 58,625,249 S79F probably benign Het
Olfr323 C G 11: 58,625,304 G61R probably benign Het
Olfr323 G A 11: 58,625,762 P95S probably benign Het
Olfr323 T G 11: 58,625,793 K84N probably benign Het
Olfr323 A C 11: 58,625,906 C46G possibly damaging Het
Olfr324 A C 11: 58,597,518 I35L probably benign Het
Olfr324 A G 11: 58,597,530 I39V probably benign Het
Olfr324 A G 11: 58,597,665 S84G possibly damaging Het
Olfr324 A G 11: 58,597,950 S179G probably benign Het
Olfr325 C T 11: 58,580,924 H27Y probably benign Het
Olfr325 T C 11: 58,580,931 V29A probably benign Het
Olfr325 G A 11: 58,581,002 V53I probably benign Het
Olfr325 T G 11: 58,581,296 L151V probably benign Het
Olfr325 G C 11: 58,581,657 S271T probably benign Het
Olfr328 T C 11: 58,551,561 K226R probably benign Het
Olfr328 C T 11: 58,551,975 S88N probably benign Het
Olfr328 C T 11: 58,552,114 A42T probably benign Het
Olfr329-ps G T 11: 58,543,446 S23Y probably benign Het
Olfr331 T C 11: 58,501,648 M309V probably benign Het
Olfr331 T C 11: 58,502,101 I158V probably benign Het
Olfr331 C A 11: 58,502,110 V155F probably benign Het
Olfr331 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,502,386 probably benign Het
Olfr331 C G 11: 58,502,461 V38L probably benign Het
Olfr331 C T 11: 58,502,570 M1I probably null Het
Olfr332 C A 11: 58,489,748 E336* probably null Het
Olfr332 C T 11: 58,490,297 A153T probably benign Het
Olfr332 T C 11: 58,490,488 Q89R probably benign Het
Olfr816 G C 10: 129,911,957 A107G possibly damaging Het
Ovca2 T C 11: 75,178,702 T32A probably benign Het
Pimreg TCACA TCA 11: 72,044,975 probably benign Het
Pimreg G A 11: 72,045,153 R154H probably damaging Het
Pitpnm3 T C 11: 72,064,129 K520E probably benign Het
Pitpnm3 C T 11: 72,120,143 R21Q probably benign Het
Prpsap2 A C 11: 61,756,252 V21G possibly damaging Het
Rabep1 C CT 11: 70,940,084 probably null Het
Rai1 A G 11: 60,187,563 N818D probably benign Het
Rap1gap2 C T 11: 74,596,895 E52K probably benign Het
Rbm6 G T 9: 107,777,972 S1020Y probably damaging Het
Rhpn2 G T 7: 35,385,401 E573D probably benign Het
Rnf112 A G 11: 61,450,949 L343P unknown Het
Rnf167 CTT CACAGGGATT 11: 70,650,820 probably null Het
Rpp40 C T 13: 35,896,756 V355I probably benign Het
Rtn4rl1 C T 11: 75,266,037 P432S probably benign Het
Setd5 C A 6: 113,114,996 N259K probably benign Het
Shisa6 TGGCCGC TGGCCGCGGCCGC 11: 66,525,691 probably benign Het
Sidt1 A G 16: 44,257,931 probably null Het
Slc2a4 GGCCG GG 11: 69,943,992 probably benign Het
Slc2a4 GCC G 11: 69,943,993 probably null Het
Slc39a9 G C 12: 80,644,728 probably benign Het
Slc7a10 A G 7: 35,186,531 H17R probably benign Het
Smcr8 A G 11: 60,777,980 probably benign Het
Smcr8 T C 11: 60,779,106 V360A probably benign Het
Smcr8 C A 11: 60,779,873 R616S probably benign Het
Smg6 G T 11: 75,156,266 A1262S probably benign Het
Sp140 G C 1: 85,641,803 R378T probably damaging Het
Spns3 T C 11: 72,550,037 I58V probably benign Het
Spns3 G A 11: 72,550,091 P40S probably benign Het
Spns3 T C 11: 72,550,160 S17G probably benign Het
Srebf1 C T 11: 60,206,235 V256M probably benign Het
Sycp2 C A 2: 178,350,869 R1296L probably benign Het
Tbata G C 10: 61,186,393 E337D probably benign Het
Tekt1 T C 11: 72,359,771 Q33R probably benign Het
Thop1 C T 10: 81,073,209 R25C probably damaging Het
Tmem102 C G 11: 69,805,076 G53A possibly damaging Het
Tmem102 G C 11: 69,805,101 R45G probably benign Het
Tmem11 A G 11: 60,875,832 probably benign Het
Tom1l2 C T 11: 60,241,856 A414T probably benign Het
Top3a C T 11: 60,750,584 G425S probably benign Het
Trim16 C T 11: 62,820,602 A33V probably benign Het
Trim16 G C 11: 62,820,676 V58L probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,820,690 probably benign Het
Trim16 G A 11: 62,836,817 E322K probably benign Het
Trim16 T C 11: 62,840,746 V481A probably benign Het
Trim16 C A 11: 62,840,849 D515E probably benign Het
Trim17 G A 11: 58,965,505 M129I probably benign Het
Trim17 A G 11: 58,970,446 N259S probably benign Het
Trim58 C A 11: 58,640,858 L131M possibly damaging Het
Trim58 A G 11: 58,651,660 N482S probably benign Het
Trpv1 C G 11: 73,240,601 P322A possibly damaging Het
Trpv1 C A 11: 73,254,291 D734E probably benign Het
Trpv3 C T 11: 73,269,687 A9V probably benign Het
Trpv3 G A 11: 73,278,977 A125T probably benign Het
Trpv3 A G 11: 73,283,676 T290A probably benign Het
Tshz3 T C 7: 36,768,916 I110T probably benign Het
Tshz3 A G 7: 36,770,574 S663G probably benign Het
Tvp23b A C 11: 62,881,943 N7H possibly damaging Het
Ubap2l G T 3: 90,009,236 H915Q unknown Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,855,719 probably benign Het
Usp43 C T 11: 67,856,506 G792S probably benign Het
Utrn C T 10: 12,669,747 R1718H probably damaging Het
Vamp2 C T 11: 69,088,585 probably benign Het
Vamp2 G A 11: 69,090,063 G124R possibly damaging Het
Wfdc6b C T 2: 164,613,671 probably benign Het
Xaf1 G A 11: 72,306,600 R134H probably benign Het
Xaf1 G C 11: 72,306,603 C135S probably damaging Het
Xaf1 C A 11: 72,306,608 L137I probably benign Het
Xaf1 A G 11: 72,308,650 E71G probably benign Het
Xaf1 T G 11: 72,308,966 C176W unknown Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,309,020 probably null Het
Xaf1 T TAGCCAGCC 11: 72,309,023 probably null Het
Xaf1 G C 11: 72,309,030 V198L unknown Het
Xaf1 T C 11: 72,309,055 L206S unknown Het
Zbtb1 A G 12: 76,385,249 K3R probably benign Het
Zfp286 G A 11: 62,784,956 T60M probably damaging Het
Zfp286 A G 11: 62,787,969 V44A probably benign Het
Zfp287 C T 11: 62,713,807 R758H probably benign Het
Zfp287 C G 11: 62,715,349 C244S probably benign Het
Zfp287 G A 11: 62,722,931 R225* probably null Het
Zfp39 G C 11: 58,890,045 Y630* probably null Het
Zfp39 A C 11: 58,890,047 Y630D probably benign Het
Zfp39 G C 11: 58,890,304 T544R possibly damaging Het
Zfp39 G C 11: 58,890,447 D496E probably benign Het
Zfp39 T C 11: 58,890,448 D496G possibly damaging Het
Zfp39 T C 11: 58,890,700 N412S possibly damaging Het
Zfp39 G T 11: 58,890,771 N388K probably benign Het
Zfp39 A G 11: 58,890,779 S386P probably benign Het
Zfp39 A C 11: 58,890,876 H353Q probably damaging Het
Zfp39 A C 11: 58,890,886 V350G probably benign Het
Zfp39 A G 11: 58,890,898 V346A probably benign Het
Zfp39 T A 11: 58,890,925 K337M probably benign Het
Zfp39 T A 11: 58,891,141 H265L probably damaging Het
Zfp39 A G 11: 58,891,297 I213T probably benign Het
Zfp39 T C 11: 58,891,316 K207E probably benign Het
Zfp39 G T 11: 58,900,581 S93R probably benign Het
Zfp39 T G 11: 58,900,583 S93R probably benign Het
Zfp536 C T 7: 37,479,560 G1207S probably benign Het
Zfp536 T C 7: 37,480,073 T1036A probably benign Het
Zfp536 T A 7: 37,480,483 Y899F probably benign Het
Zfp672 G T 11: 58,329,626 T49K unknown Het
Zfp672 C A 11: 58,329,960 probably benign Het
Zfp692 G T 11: 58,309,033 E149D probably benign Het
Zfp692 G A 11: 58,310,018 V242I probably benign Het
Zzef1 G A 11: 72,889,182 R1927H probably benign Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 67815928 missense probably benign
IGL00336:Lama1 APN 17 67813948 missense probably benign 0.07
IGL01066:Lama1 APN 17 67743326 missense probably damaging 1.00
IGL01140:Lama1 APN 17 67802933 missense probably benign 0.14
IGL01291:Lama1 APN 17 67738870 missense probably damaging 1.00
IGL01296:Lama1 APN 17 67745051 missense probably benign 0.27
IGL01317:Lama1 APN 17 67818701 missense probably damaging 1.00
IGL01490:Lama1 APN 17 67750584 missense possibly damaging 0.54
IGL01506:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01508:Lama1 APN 17 67809361 splice site probably benign
IGL01522:Lama1 APN 17 67752774 splice site probably benign
IGL01530:Lama1 APN 17 67796790 missense probably benign 0.02
IGL01541:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01677:Lama1 APN 17 67779148 missense probably benign 0.15
IGL01886:Lama1 APN 17 67807797 missense probably benign 0.36
IGL01994:Lama1 APN 17 67752439 missense probably benign 0.05
IGL02017:Lama1 APN 17 67764725 missense probably benign 0.00
IGL02021:Lama1 APN 17 67821626 missense probably damaging 1.00
IGL02026:Lama1 APN 17 67809292 missense possibly damaging 0.82
IGL02044:Lama1 APN 17 67811490 missense probably benign 0.01
IGL02120:Lama1 APN 17 67716789 missense probably damaging 1.00
IGL02425:Lama1 APN 17 67811485 missense probably benign 0.45
IGL02549:Lama1 APN 17 67790835 missense possibly damaging 0.93
IGL02642:Lama1 APN 17 67812366 missense probably benign 0.00
IGL02795:Lama1 APN 17 67738894 splice site probably null
IGL02798:Lama1 APN 17 67795191 splice site probably benign
IGL02863:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02870:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02876:Lama1 APN 17 67750692 critical splice donor site probably null
IGL02885:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02891:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02978:Lama1 APN 17 67786081 nonsense probably null
IGL03064:Lama1 APN 17 67779104 missense probably benign 0.01
IGL03076:Lama1 APN 17 67716799 missense possibly damaging 0.95
IGL03110:Lama1 APN 17 67798986 missense probably benign 0.04
IGL03143:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03159:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03268:Lama1 APN 17 67804536 missense probably damaging 0.99
ANU05:Lama1 UTSW 17 67738870 missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 67764704 missense
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0050:Lama1 UTSW 17 67782056 missense possibly damaging 0.66
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0111:Lama1 UTSW 17 67737498 missense probably damaging 0.98
R0116:Lama1 UTSW 17 67776923 missense probably benign 0.10
R0121:Lama1 UTSW 17 67798513 splice site probably benign
R0278:Lama1 UTSW 17 67810183 missense probably null 0.98
R0281:Lama1 UTSW 17 67817569 missense probably damaging 1.00
R0312:Lama1 UTSW 17 67775851 missense possibly damaging 0.45
R0419:Lama1 UTSW 17 67791610 critical splice donor site probably null
R0512:Lama1 UTSW 17 67779134 missense possibly damaging 0.67
R0514:Lama1 UTSW 17 67764698 missense probably benign 0.40
R0562:Lama1 UTSW 17 67815959 missense probably damaging 1.00
R0632:Lama1 UTSW 17 67752368 splice site probably benign
R0645:Lama1 UTSW 17 67773712 missense probably benign 0.01
R0712:Lama1 UTSW 17 67779042 splice site probably null
R0763:Lama1 UTSW 17 67772818 missense probably damaging 0.97
R0941:Lama1 UTSW 17 67775865 missense probably benign 0.10
R1025:Lama1 UTSW 17 67752898 missense probably benign 0.00
R1084:Lama1 UTSW 17 67804469 missense probably benign 0.12
R1103:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1420:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1430:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R1569:Lama1 UTSW 17 67780618 splice site probably null
R1575:Lama1 UTSW 17 67810409 missense possibly damaging 0.96
R1613:Lama1 UTSW 17 67807923 missense probably benign 0.42
R1620:Lama1 UTSW 17 67767033 missense probably benign 0.01
R1629:Lama1 UTSW 17 67805428 missense probably benign 0.00
R1645:Lama1 UTSW 17 67737682 missense probably benign 0.14
R1652:Lama1 UTSW 17 67807846 missense probably damaging 0.97
R1674:Lama1 UTSW 17 67791244 missense probably benign
R1678:Lama1 UTSW 17 67810155 missense possibly damaging 0.56
R1710:Lama1 UTSW 17 67753791 missense probably benign 0.00
R1712:Lama1 UTSW 17 67717186 missense possibly damaging 0.95
R1737:Lama1 UTSW 17 67802921 missense probably benign 0.36
R1757:Lama1 UTSW 17 67763836 missense probably benign 0.40
R1757:Lama1 UTSW 17 67697383 missense unknown
R1813:Lama1 UTSW 17 67791223 missense probably benign
R1896:Lama1 UTSW 17 67791223 missense probably benign
R1945:Lama1 UTSW 17 67745853 missense probably benign 0.14
R2086:Lama1 UTSW 17 67817623 missense probably damaging 1.00
R2149:Lama1 UTSW 17 67773865 missense possibly damaging 0.95
R2178:Lama1 UTSW 17 67769515 missense probably benign 0.07
R2183:Lama1 UTSW 17 67791009 missense probably damaging 0.98
R2197:Lama1 UTSW 17 67752941 missense probably benign 0.02
R2213:Lama1 UTSW 17 67777034 nonsense probably null
R2260:Lama1 UTSW 17 67737507 missense probably damaging 0.96
R2356:Lama1 UTSW 17 67810114 missense probably damaging 1.00
R2420:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2421:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2422:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2424:Lama1 UTSW 17 67798665 missense probably benign 0.09
R2442:Lama1 UTSW 17 67768317 missense probably benign 0.04
R3147:Lama1 UTSW 17 67737658 missense probably damaging 0.98
R3414:Lama1 UTSW 17 67737603 missense probably damaging 1.00
R3683:Lama1 UTSW 17 67768333 missense probably benign 0.40
R3820:Lama1 UTSW 17 67779046 splice site probably null
R3821:Lama1 UTSW 17 67779046 splice site probably null
R3822:Lama1 UTSW 17 67779046 splice site probably null
R4012:Lama1 UTSW 17 67812373 nonsense probably null
R4113:Lama1 UTSW 17 67764703 missense probably benign 0.01
R4133:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R4133:Lama1 UTSW 17 67812486 missense probably damaging 1.00
R4259:Lama1 UTSW 17 67752418 missense possibly damaging 0.95
R4278:Lama1 UTSW 17 67791517 missense probably null 0.00
R4321:Lama1 UTSW 17 67771083 missense probably benign 0.03
R4374:Lama1 UTSW 17 67804518 missense probably benign 0.00
R4386:Lama1 UTSW 17 67773712 missense probably benign 0.01
R4463:Lama1 UTSW 17 67761700 missense probably damaging 1.00
R4629:Lama1 UTSW 17 67805360 critical splice acceptor site probably null
R4630:Lama1 UTSW 17 67794300 missense probably benign 0.00
R4633:Lama1 UTSW 17 67798584 missense probably damaging 0.96
R4668:Lama1 UTSW 17 67752434 missense probably benign 0.27
R4684:Lama1 UTSW 17 67773778 missense possibly damaging 0.88
R4745:Lama1 UTSW 17 67738780 missense probably damaging 1.00
R4786:Lama1 UTSW 17 67773859 missense possibly damaging 0.77
R4797:Lama1 UTSW 17 67716775 missense probably benign 0.04
R4803:Lama1 UTSW 17 67809271 missense probably damaging 1.00
R4925:Lama1 UTSW 17 67794314 missense probably benign 0.02
R4939:Lama1 UTSW 17 67737475 missense possibly damaging 0.91
R4952:Lama1 UTSW 17 67767566 critical splice donor site probably null
R4975:Lama1 UTSW 17 67738834 missense possibly damaging 0.95
R4977:Lama1 UTSW 17 67737682 missense probably damaging 1.00
R5039:Lama1 UTSW 17 67745893 missense possibly damaging 0.66
R5047:Lama1 UTSW 17 67743281 nonsense probably null
R5195:Lama1 UTSW 17 67764800 missense probably benign 0.13
R5230:Lama1 UTSW 17 67745083 nonsense probably null
R5236:Lama1 UTSW 17 67804492 missense probably benign 0.24
R5254:Lama1 UTSW 17 67756716 missense probably benign 0.01
R5345:Lama1 UTSW 17 67817563 missense probably benign
R5438:Lama1 UTSW 17 67800774 missense possibly damaging 0.92
R5521:Lama1 UTSW 17 67780894 nonsense probably null
R5568:Lama1 UTSW 17 67768298 critical splice acceptor site probably null
R5645:Lama1 UTSW 17 67802948 missense probably damaging 1.00
R5665:Lama1 UTSW 17 67770987 missense probably damaging 1.00
R5727:Lama1 UTSW 17 67815224 missense possibly damaging 0.81
R5757:Lama1 UTSW 17 67738787 missense possibly damaging 0.59
R5795:Lama1 UTSW 17 67796727 missense probably benign 0.02
R5857:Lama1 UTSW 17 67807843 missense probably damaging 0.99
R5894:Lama1 UTSW 17 67779047 critical splice acceptor site probably null
R5974:Lama1 UTSW 17 67773727 missense probably benign 0.31
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6120:Lama1 UTSW 17 67780617 critical splice donor site probably null
R6219:Lama1 UTSW 17 67790856 missense probably benign 0.08
R6224:Lama1 UTSW 17 67802987 missense possibly damaging 0.56
R6249:Lama1 UTSW 17 67798604 missense probably benign
R6265:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R6276:Lama1 UTSW 17 67784088 splice site probably null
R6284:Lama1 UTSW 17 67810096 missense probably damaging 0.99
R6337:Lama1 UTSW 17 67786019 missense probably benign 0.27
R6414:Lama1 UTSW 17 67746910 critical splice donor site probably null
R6631:Lama1 UTSW 17 67774482 missense probably benign 0.21
R6659:Lama1 UTSW 17 67818635 missense probably damaging 1.00
R6660:Lama1 UTSW 17 67804500 missense probably benign 0.05
R6677:Lama1 UTSW 17 67795233 missense probably benign 0.14
R6763:Lama1 UTSW 17 67746873 missense unknown
R6787:Lama1 UTSW 17 67784025 missense unknown
R6831:Lama1 UTSW 17 67756754 missense possibly damaging 0.89
R6855:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R6910:Lama1 UTSW 17 67791464 missense possibly damaging 0.60
R6934:Lama1 UTSW 17 67774543 missense probably benign 0.04
R6945:Lama1 UTSW 17 67813866 missense
R6984:Lama1 UTSW 17 67779112 missense
R6989:Lama1 UTSW 17 67753758 missense
R6994:Lama1 UTSW 17 67753825 missense
R6995:Lama1 UTSW 17 67753825 missense
R7035:Lama1 UTSW 17 67781049 missense
R7133:Lama1 UTSW 17 67782146 missense
R7172:Lama1 UTSW 17 67804545 missense
R7197:Lama1 UTSW 17 67737705 nonsense probably null
R7217:Lama1 UTSW 17 67764673 missense
R7229:Lama1 UTSW 17 67752446 missense
R7264:Lama1 UTSW 17 67743297 missense
R7311:Lama1 UTSW 17 67767385 missense
R7394:Lama1 UTSW 17 67717261 missense
R7419:Lama1 UTSW 17 67717174 missense
R7460:Lama1 UTSW 17 67767018 missense
R7492:Lama1 UTSW 17 67817651 missense
R7494:Lama1 UTSW 17 67811446 missense
R7552:Lama1 UTSW 17 67737667 missense
R7576:Lama1 UTSW 17 67782041 missense
R7583:Lama1 UTSW 17 67761621 missense
R7649:Lama1 UTSW 17 67737554 missense
R7663:Lama1 UTSW 17 67780880 missense
R7667:Lama1 UTSW 17 67780597 missense
R7688:Lama1 UTSW 17 67761628 missense
R7693:Lama1 UTSW 17 67817031 missense
R7748:Lama1 UTSW 17 67750590 missense
R7778:Lama1 UTSW 17 67804473 missense
R7824:Lama1 UTSW 17 67804473 missense
R7861:Lama1 UTSW 17 67809221 missense
R7884:Lama1 UTSW 17 67769435 missense
R8029:Lama1 UTSW 17 67817594 missense
R8078:Lama1 UTSW 17 67791294 missense
R8101:Lama1 UTSW 17 67745922 missense
R8313:Lama1 UTSW 17 67750520 missense
R8356:Lama1 UTSW 17 67737496 missense
R8366:Lama1 UTSW 17 67818704 missense
R8403:Lama1 UTSW 17 67745923 missense
R8456:Lama1 UTSW 17 67737496 missense
R8466:Lama1 UTSW 17 67813953 missense
R8678:Lama1 UTSW 17 67817103 missense
R8728:Lama1 UTSW 17 67818668 missense
R8796:Lama1 UTSW 17 67810151 missense
R8885:Lama1 UTSW 17 67773784 missense
R8893:Lama1 UTSW 17 67805372 missense
R8898:Lama1 UTSW 17 67821615 missense
R8909:Lama1 UTSW 17 67772741 missense
R9025:Lama1 UTSW 17 67812496 missense
R9045:Lama1 UTSW 17 67753843 missense
R9098:Lama1 UTSW 17 67804513 missense
R9114:Lama1 UTSW 17 67821674 missense
R9173:Lama1 UTSW 17 67769602 missense
R9190:Lama1 UTSW 17 67804519 missense
R9381:Lama1 UTSW 17 67737484 missense
R9429:Lama1 UTSW 17 67811454 missense
R9504:Lama1 UTSW 17 67821666 missense
R9558:Lama1 UTSW 17 67817009 missense
RF001:Lama1 UTSW 17 67752902 missense
RF013:Lama1 UTSW 17 67781062 missense
V8831:Lama1 UTSW 17 67752883 missense probably benign 0.00
X0024:Lama1 UTSW 17 67738888 missense probably damaging 1.00
X0028:Lama1 UTSW 17 67767422 missense probably benign 0.00
X0028:Lama1 UTSW 17 67794310 missense probably benign 0.06
X0066:Lama1 UTSW 17 67811566 missense probably damaging 1.00
Z1088:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1088:Lama1 UTSW 17 67771082 missense probably benign 0.25
Z1088:Lama1 UTSW 17 67810171 missense probably damaging 1.00
Z1176:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1177:Lama1 UTSW 17 67752883 missense probably benign 0.00
Predicted Primers
Posted On 2021-03-08