Incidental Mutation 'Z1192:Dnah9'
ID 667667
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.403) question?
Stock # Z1192 ()
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 65722150-66059379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66038207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 110 (H110Y)
Ref Sequence ENSEMBL: ENSMUSP00000104331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665] [ENSMUST00000108691]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080665
AA Change: H308Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: H308Y

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108691
AA Change: H110Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104331
Gene: ENSMUSG00000056752
AA Change: H110Y

DomainStartEndE-ValueType
Pfam:DHC_N1 10 457 2.3e-141 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 391 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,044,114 (GRCm39) W27R unknown Het
1700086D15Rik A G 11: 65,044,080 (GRCm39) F38S unknown Het
1700086D15Rik A C 11: 65,043,809 (GRCm39) V84G unknown Het
1700086D15Rik T A 11: 65,043,794 (GRCm39) Q89L unknown Het
1700086D15Rik A G 11: 65,044,128 (GRCm39) L22P unknown Het
1810065E05Rik C T 11: 58,313,027 (GRCm39) L27F probably benign Het
1810065E05Rik C T 11: 58,316,625 (GRCm39) L202F probably benign Het
1810065E05Rik C T 11: 58,313,060 (GRCm39) L38F possibly damaging Het
2810021J22Rik C T 11: 58,771,361 (GRCm39) A281V probably benign Het
4930438A08Rik A G 11: 58,184,844 (GRCm39) T521A unknown Het
4933427D14Rik G A 11: 72,067,535 (GRCm39) T585I possibly damaging Het
4933427D14Rik T G 11: 72,089,750 (GRCm39) S45R probably damaging Het
4933427D14Rik C A 11: 72,089,360 (GRCm39) A175S probably benign Het
4933427D14Rik G A 11: 72,089,308 (GRCm39) P192L probably benign Het
4933427D14Rik T C 11: 72,086,595 (GRCm39) Q272R probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,086,590 (GRCm39) probably null Het
4933427D14Rik T G 11: 72,086,580 (GRCm39) K277T probably damaging Het
4933427D14Rik A G 11: 72,086,569 (GRCm39) C281R possibly damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,086,538 (GRCm39) probably null Het
4933427D14Rik G T 11: 72,080,442 (GRCm39) P408H probably damaging Het
Adgra3 G A 5: 50,156,623 (GRCm39) T369I probably benign Het
Akap10 T A 11: 61,806,096 (GRCm39) S211C probably benign Het
Alox8 C T 11: 69,076,873 (GRCm39) R536Q probably benign Het
Alox8 A G 11: 69,088,322 (GRCm39) V76A probably benign Het
Aloxe3 A G 11: 69,019,501 (GRCm39) Q138R probably benign Het
Aloxe3 C T 11: 69,039,429 (GRCm39) A667V probably benign Het
Ank2 A G 3: 126,749,601 (GRCm39) F476S probably damaging Het
Arsk G T 13: 76,246,637 (GRCm39) probably benign Het
Aspa G T 11: 73,213,013 (GRCm39) L110I probably benign Het
Atp6v1g3 A G 1: 138,201,582 (GRCm39) K27E possibly damaging Het
Aurkb C T 11: 68,938,692 (GRCm39) R44W probably damaging Het
Aurkb T C 11: 68,938,696 (GRCm39) F45S probably benign Het
B9d1 A T 11: 61,396,029 (GRCm39) probably benign Het
BC034090 A G 1: 155,117,245 (GRCm39) I291T probably benign Het
Borcs6 G A 11: 68,951,453 (GRCm39) R277Q possibly damaging Het
Btbd3 ATCGGGGTCG ATCG 2: 138,126,010 (GRCm39) probably benign Het
Btnl10 T C 11: 58,810,138 (GRCm39) V93A probably benign Het
Btnl10 C T 11: 58,817,650 (GRCm39) T250I unknown Het
Btnl10 A AAGC 11: 58,814,757 (GRCm39) probably benign Het
Btnl10 AAG AAGGAG 11: 58,814,754 (GRCm39) probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,814,753 (GRCm39) probably benign Het
Btnl9 C T 11: 49,066,805 (GRCm39) R272H unknown Het
Camsap3 G T 8: 3,654,124 (GRCm39) R598L probably damaging Het
Ccdc42 C T 11: 68,478,017 (GRCm39) probably benign Het
Ccdc92b A G 11: 74,520,880 (GRCm39) M61V possibly damaging Het
Chd3 C A 11: 69,239,271 (GRCm39) E1753D probably benign Het
Chd3 A G 11: 69,252,277 (GRCm39) W42R probably benign Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,560,343 (GRCm39) probably benign Het
Cluh AGCCTG AGCCTGGGCCTG 11: 74,560,351 (GRCm39) probably benign Het
Cnot9 T A 1: 74,556,285 (GRCm39) N27K probably benign Het
Cntrob C T 11: 69,196,404 (GRCm39) R677H probably benign Het
Cntrob G A 11: 69,198,882 (GRCm39) P622L probably benign Het
Cyb5d1 A G 11: 69,286,028 (GRCm39) L31P probably benign Het
Cyb5d1 C A 11: 69,286,098 (GRCm39) A8S probably benign Het
Dach1 G A 14: 98,140,587 (GRCm39) P524S probably benign Het
Dpysl4 A G 7: 138,669,324 (GRCm39) M1V probably null Het
Eif2b5 C T 16: 20,317,671 (GRCm39) A3V unknown Het
Elac2 T C 11: 64,870,015 (GRCm39) S27P probably benign Het
Epn2 C A 11: 61,470,460 (GRCm39) probably benign Het
Fam114a2 G A 11: 57,380,940 (GRCm39) A438V probably benign Het
Fam114a2 T C 11: 57,390,623 (GRCm39) N304D probably benign Het
Fam114a2 C T 11: 57,405,060 (GRCm39) G14E probably benign Het
Fam114a2 A G 11: 57,374,858 (GRCm39) S494P probably benign Het
Fam114a2 C T 11: 57,390,581 (GRCm39) V318I probably benign Het
Fam83g G A 11: 61,594,020 (GRCm39) R518Q probably benign Het
Fat2 T G 11: 55,200,625 (GRCm39) K816N probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,199,796 (GRCm39) probably null Het
Fbxw10 G C 11: 62,738,118 (GRCm39) R4T probably benign Het
Fbxw10 G A 11: 62,767,671 (GRCm39) V836I probably benign Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Gemin5 C G 11: 58,013,115 (GRCm39) S1446T probably benign Het
Gemin5 T C 11: 58,016,044 (GRCm39) S1321G probably benign Het
Gemin5 T C 11: 58,020,897 (GRCm39) M1097V probably benign Het
Gemin5 C G 11: 58,030,336 (GRCm39) A830P probably benign Het
Gemin5 C G 11: 58,030,401 (GRCm39) C808S probably benign Het
Gemin5 C G 11: 58,037,345 (GRCm39) E623D probably benign Het
Ggnbp2 C T 11: 84,727,478 (GRCm39) R481Q probably benign Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,073,561 (GRCm39) probably benign Het
Gjc2 A G 11: 59,067,318 (GRCm39) V388A unknown Het
Glod4 A G 11: 76,133,836 (GRCm39) V6A probably benign Het
Glod4 T C 11: 76,134,430 (GRCm39) K14R probably benign Het
Glod4 T C 11: 76,134,431 (GRCm39) K14E probably benign Het
Glod4 C A 11: 76,133,819 (GRCm39) probably null Het
Glp2r C A 11: 67,600,470 (GRCm39) V460F probably benign Het
Glp2r C G 11: 67,600,472 (GRCm39) G459A probably benign Het
Glp2r A G 11: 67,631,878 (GRCm39) V283A probably benign Het
Glp2r T C 11: 67,631,885 (GRCm39) I281V probably benign Het
Glp2r T C 11: 67,633,129 (GRCm39) T235A probably benign Het
Glp2r A G 11: 67,635,773 (GRCm39) V189A probably benign Het
Glp2r C A 11: 67,661,662 (GRCm39) A13S probably benign Het
Glp2r C A 11: 67,600,394 (GRCm39) R485L probably damaging Het
Gm12253 A G 11: 58,325,658 (GRCm39) E43G probably benign Het
Gm12253 G C 11: 58,325,367 (GRCm39) S13T possibly damaging Het
Gm12253 G A 11: 58,331,835 (GRCm39) A215T possibly damaging Het
Gm12253 G A 11: 58,326,309 (GRCm39) S108N probably benign Het
Gm12253 A C 11: 58,326,237 (GRCm39) E84A probably benign Het
Gm12253 A C 11: 58,325,686 (GRCm39) E52D probably benign Het
Gm12258 C T 11: 58,749,262 (GRCm39) R146W Het
Gm12258 T G 11: 58,749,126 (GRCm39) S100R Het
Gm12258 G C 11: 58,750,690 (GRCm39) G622R unknown Het
Gm12258 T A 11: 58,750,014 (GRCm39) probably benign Het
Gm12258 A G 11: 58,750,013 (GRCm39) probably benign Het
Gm12258 A T 11: 58,749,833 (GRCm39) E336V unknown Het
Gm12258 G A 11: 58,749,776 (GRCm39) G317E unknown Het
Gm12258 G A 11: 58,749,764 (GRCm39) R313H unknown Het
Gps2 C T 11: 69,807,130 (GRCm39) A60V probably benign Het
Gucy2e C G 11: 69,127,429 (GRCm39) G15R unknown Het
Gucy2e C A 11: 69,114,431 (GRCm39) A1033S probably benign Het
Haspin A G 11: 73,028,777 (GRCm39) L104P probably benign Het
Haspin T C 11: 73,028,174 (GRCm39) Q305R probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hic1 GGGAGG GGG 11: 75,060,276 (GRCm39) probably benign Het
Hic1 G A 11: 75,058,352 (GRCm39) T179M probably damaging Het
Iba57 T C 11: 59,052,381 (GRCm39) T87A unknown Het
Iba57 CAGA CAGAGA 11: 59,052,329 (GRCm39) probably null Het
Iba57 C G 11: 59,053,865 (GRCm39) G36R unknown Het
Iba57 T C 11: 59,052,384 (GRCm39) T86A unknown Het
Ifi207 G A 1: 173,558,093 (GRCm39) T215I unknown Het
Iftap T C 2: 101,440,950 (GRCm39) K18E probably benign Het
Igtp C G 11: 58,097,791 (GRCm39) L321V possibly damaging Het
Igtp T G 11: 58,097,169 (GRCm39) D113E probably damaging Het
Igtp C G 11: 58,097,944 (GRCm39) L372V probably benign Het
Ihh G C 1: 74,990,204 (GRCm39) P57R probably damaging Het
Insrr T C 3: 87,709,886 (GRCm39) C280R probably damaging Het
Irgm2 T C 11: 58,110,738 (GRCm39) I143T probably benign Het
Irgm2 T C 11: 58,110,780 (GRCm39) L157S probably benign Het
Irgm2 G A 11: 58,110,833 (GRCm39) V175I probably benign Het
Irgm2 G A 11: 58,110,924 (GRCm39) S205N probably benign Het
Irgm2 A C 11: 58,110,951 (GRCm39) H214P probably benign Het
Irgm2 G T 11: 58,111,238 (GRCm39) A310S possibly damaging Het
Irgm2 C G 11: 58,111,389 (GRCm39) T360S probably benign Het
Irgm2 T A 11: 58,110,339 (GRCm39) V10D probably benign Het
Irgm2 A G 11: 58,110,389 (GRCm39) N27D probably benign Het
Itgae C G 11: 73,024,953 (GRCm39) S1028W probably benign Het
Itgae G T 11: 73,012,783 (GRCm39) G705V probably benign Het
Itgae A T 11: 73,012,757 (GRCm39) K696N probably benign Het
Itgae G A 11: 73,008,913 (GRCm39) V465I probably benign Het
Itgae A G 11: 73,006,466 (GRCm39) H378R probably benign Het
Itgae A T 11: 72,994,786 (GRCm39) Q46L probably damaging Het
Itgae T A 11: 72,994,713 (GRCm39) L22M possibly damaging Het
Kif1c C T 11: 70,614,940 (GRCm39) P578L probably benign Het
Kmt2d T C 15: 98,749,625 (GRCm39) N2656D unknown Het
Larp1 G A 11: 57,933,166 (GRCm39) V257I probably benign Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,603,923 (GRCm39) probably null Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAAGA 11: 58,281,069 (GRCm39) probably benign Het
Lypd8 ACA ACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCACCA 11: 58,281,068 (GRCm39) probably benign Het
Lypd8 ATCACCAACA ATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAACTCACCAACA 11: 58,281,061 (GRCm39) probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,281,059 (GRCm39) probably benign Het
Lypd8 G A 11: 58,275,489 (GRCm39) E75K probably benign Het
Lypd8 C A 11: 58,275,475 (GRCm39) A70E possibly damaging Het
Lypd8 T C 11: 58,273,601 (GRCm39) Y27H probably benign Het
Lypd8l G A 11: 58,499,335 (GRCm39) P161L probably benign Het
Lypd8l T G 11: 58,503,397 (GRCm39) S44R probably benign Het
Lypd8l A G 11: 58,503,387 (GRCm39) L47P probably benign Het
Maml3 A T 3: 51,763,165 (GRCm39) L600M probably damaging Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,381,053 (GRCm39) probably benign Het
Mfap3 A T 11: 57,418,866 (GRCm39) I9F possibly damaging Het
Mfap3 G A 11: 57,418,902 (GRCm39) G21S probably benign Het
Mrm3 G A 11: 76,134,903 (GRCm39) R102K probably benign Het
Mrm3 C T 11: 76,138,221 (GRCm39) P203L probably benign Het
Mroh2a G T 1: 88,162,938 (GRCm39) Q360H probably benign Het
Mrpl22 G A 11: 58,062,521 (GRCm39) A4T unknown Het
Mrpl55 A G 11: 59,094,999 (GRCm39) probably null Het
Mrpl55 A T 11: 59,095,415 (GRCm39) L26F probably benign Het
Myh7 A T 14: 55,220,748 (GRCm39) V1017D probably damaging Het
Myocd A G 11: 65,075,418 (GRCm39) S697P probably benign Het
Nlgn2 A G 11: 69,719,220 (GRCm39) V210A possibly damaging Het
Nlrp1a T C 11: 70,983,069 (GRCm39) K1299R probably benign Het
Nlrp1a C T 11: 70,988,077 (GRCm39) R1131Q probably damaging Het
Nlrp1a T C 11: 70,990,442 (GRCm39) I1038V probably benign Het
Nlrp1a T C 11: 71,014,914 (GRCm39) E112G probably benign Het
Nlrp1a C G 11: 71,033,355 (GRCm39) probably null Het
Nlrp1b A G 11: 71,073,148 (GRCm39) Y232H probably benign Het
Nlrp1b A T 11: 71,073,266 (GRCm39) D192E probably benign Het
Nlrp1b T C 11: 71,073,280 (GRCm39) T188A probably benign Het
Nlrp1b C G 11: 71,073,370 (GRCm39) E158Q probably benign Het
Nlrp1b A T 11: 71,073,378 (GRCm39) M155K probably benign Het
Nlrp1b T A 11: 71,073,396 (GRCm39) Q149L probably benign Het
Nlrp1b T C 11: 71,073,503 (GRCm39) I113M probably benign Het
Nlrp1b C A 11: 71,072,534 (GRCm39) M436I probably benign Het
Nlrp1b A G 11: 71,072,625 (GRCm39) I406T probably benign Het
Nmur2 T C 11: 55,931,104 (GRCm39) I202M probably benign Het
Nrp1 C A 8: 129,224,419 (GRCm39) H727Q probably damaging Het
Nsun6 C T 2: 15,042,918 (GRCm39) R181H probably damaging Het
Obscn A G 11: 58,977,565 (GRCm39) V1845A probably benign Het
Obscn A G 11: 58,984,142 (GRCm39) F1771S probably benign Het
Obscn C T 11: 58,984,239 (GRCm39) V1739M possibly damaging Het
Obscn G T 11: 58,984,334 (GRCm39) A1707D possibly damaging Het
Obscn C T 11: 58,984,335 (GRCm39) A1707T probably benign Het
Obscn G A 11: 58,984,385 (GRCm39) A1690V probably benign Het
Obscn C T 11: 58,990,735 (GRCm39) A1613T possibly damaging Het
Obscn T C 11: 58,990,755 (GRCm39) H1606R probably benign Het
Obscn C G 11: 58,994,167 (GRCm39) A1572P probably damaging Het
Obscn G A 11: 58,994,364 (GRCm39) A1506V probably benign Het
Obscn T C 11: 59,003,380 (GRCm39) E1306G probably benign Het
Obscn T C 11: 59,013,563 (GRCm39) M1095V probably benign Het
Obscn C T 11: 59,018,892 (GRCm39) A949T probably benign Het
Obscn C T 11: 59,018,895 (GRCm39) V973M probably damaging Het
Obscn C T 11: 59,021,449 (GRCm39) R797H probably damaging Het
Obscn C T 11: 59,023,937 (GRCm39) A578T possibly damaging Het
Obscn G A 11: 59,024,066 (GRCm39) P535S probably damaging Het
Obscn C G 11: 59,024,072 (GRCm39) A533P probably benign Het
Obscn T C 11: 59,026,505 (GRCm39) I233V probably benign Het
Obscn C T 11: 58,940,306 (GRCm39) D5354N Het
Obscn C A 11: 58,940,614 (GRCm39) R4593S possibly damaging Het
Obscn T C 11: 58,940,623 (GRCm39) T5307A Het
Obscn G A 11: 58,942,383 (GRCm39) T4372M probably benign Het
Obscn T C 11: 58,943,439 (GRCm39) M4237V probably benign Het
Obscn C T 11: 58,944,594 (GRCm39) R4700Q probably benign Het
Obscn T C 11: 58,944,651 (GRCm39) K4681R probably benign Het
Obscn T C 11: 58,945,044 (GRCm39) E4658G probably benign Het
Obscn C T 11: 58,945,176 (GRCm39) R4614Q probably benign Het
Obscn T C 11: 58,946,331 (GRCm39) D4458G probably damaging Het
Obscn C T 11: 58,946,340 (GRCm39) R4455K probably benign Het
Obscn G T 11: 58,946,936 (GRCm39) A4066E possibly damaging Het
Obscn A G 11: 58,947,595 (GRCm39) M4478T Het
Obscn C T 11: 58,952,388 (GRCm39) G3894R probably benign Het
Obscn T C 11: 58,954,402 (GRCm39) K3727E probably damaging Het
Obscn G A 11: 58,957,973 (GRCm39) R3576C probably benign Het
Obscn C T 11: 58,958,655 (GRCm39) V3433I probably benign Het
Obscn C A 11: 58,960,757 (GRCm39) A3185S probably benign Het
Obscn C T 11: 58,967,334 (GRCm39) V2792I possibly damaging Het
Obscn G A 11: 58,969,984 (GRCm39) R53C probably damaging Het
Obscn C G 11: 58,970,722 (GRCm39) V2328L probably benign Het
Obscn C A 11: 58,972,698 (GRCm39) G2116V possibly damaging Het
Obscn C T 11: 58,977,505 (GRCm39) R1865H probably benign Het
Obscn G A 11: 58,891,715 (GRCm39) A6939V probably benign Het
Obscn C G 11: 58,900,019 (GRCm39) G938A probably benign Het
Obscn G C 11: 58,904,014 (GRCm39) T7320S probably benign Het
Obscn C T 11: 58,921,934 (GRCm39) R5954Q probably damaging Het
Obscn G C 11: 58,929,976 (GRCm39) P5080A probably benign Het
Obscn T A 11: 58,929,990 (GRCm39) Q5075L probably damaging Het
Obscn T C 11: 58,932,601 (GRCm39) I4869V probably benign Het
Obscn T C 11: 58,933,776 (GRCm39) T5363A probably benign Het
Obscn G A 11: 58,933,853 (GRCm39) A5337V probably benign Het
Obscn G A 11: 58,933,878 (GRCm39) R5329C probably benign Het
Obscn T C 11: 58,977,527 (GRCm39) R1858G probably benign Het
Or11l3 G A 11: 58,516,075 (GRCm39) S79F probably benign Het
Or11l3 A C 11: 58,516,732 (GRCm39) C46G possibly damaging Het
Or11l3 T G 11: 58,516,619 (GRCm39) K84N probably benign Het
Or11l3 G A 11: 58,516,588 (GRCm39) P95S probably benign Het
Or11l3 C G 11: 58,516,130 (GRCm39) G61R probably benign Het
Or2ab1 A C 11: 58,488,344 (GRCm39) I35L probably benign Het
Or2ab1 A G 11: 58,488,776 (GRCm39) S179G probably benign Het
Or2ab1 A G 11: 58,488,491 (GRCm39) S84G possibly damaging Het
Or2ab1 A G 11: 58,488,356 (GRCm39) I39V probably benign Het
Or2ak4 G A 11: 58,648,793 (GRCm39) A101T probably benign Het
Or2ak4 A C 11: 58,649,186 (GRCm39) K232Q probably benign Het
Or2ak4 A C 11: 58,649,168 (GRCm39) I226L probably benign Het
Or2ak4 G A 11: 58,649,153 (GRCm39) V221M probably damaging Het
Or2ak4 A G 11: 58,648,931 (GRCm39) S147G probably benign Het
Or2ak4 C T 11: 58,648,895 (GRCm39) L135F probably benign Het
Or2ak5 G A 11: 58,611,922 (GRCm39) probably benign Het
Or2ak6 C A 11: 58,593,222 (GRCm39) Q232K probably benign Het
Or2ak6 C T 11: 58,593,153 (GRCm39) L209F possibly damaging Het
Or2ak6 A C 11: 58,592,784 (GRCm39) I86L probably benign Het
Or2ak7 G T 11: 58,574,758 (GRCm39) D20Y probably benign Het
Or2ak7 C T 11: 58,575,289 (GRCm39) H197Y probably benign Het
Or2ak7 G A 11: 58,575,083 (GRCm39) R128Q probably benign Het
Or2ak7 T C 11: 58,574,815 (GRCm39) F39L probably benign Het
Or2av9 C A 11: 58,380,574 (GRCm39) E336* probably null Het
Or2av9 T C 11: 58,381,314 (GRCm39) Q89R probably benign Het
Or2av9 C T 11: 58,381,123 (GRCm39) A153T probably benign Het
Or2t29 G T 11: 58,434,272 (GRCm39) S23Y probably benign Het
Or2t43 A T 11: 58,457,521 (GRCm39) S217T probably benign Het
Or2t43 C T 11: 58,457,920 (GRCm39) V84I probably benign Het
Or2t43 G A 11: 58,457,388 (GRCm39) A261V probably benign Het
Or2t44 A G 11: 58,677,773 (GRCm39) T238A probably damaging Het
Or2t46 T G 11: 58,472,122 (GRCm39) L151V probably benign Het
Or2t46 G C 11: 58,472,483 (GRCm39) S271T probably benign Het
Or2t46 C T 11: 58,471,750 (GRCm39) H27Y probably benign Het
Or2t46 T C 11: 58,471,757 (GRCm39) V29A probably benign Het
Or2t47 C T 11: 58,442,940 (GRCm39) A42T probably benign Het
Or2t47 T C 11: 58,442,387 (GRCm39) K226R probably benign Het
Or2t47 C T 11: 58,442,801 (GRCm39) S88N probably benign Het
Or2t49 C T 11: 58,393,396 (GRCm39) M1I probably null Het
Or2t49 GAGGTGGATTGGTA GA 11: 58,393,210 (GRCm39) probably benign Het
Or2t49 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,393,212 (GRCm39) probably benign Het
Or2t49 C G 11: 58,393,287 (GRCm39) V38L probably benign Het
Or2w3 T G 11: 58,557,342 (GRCm39) I319R probably benign Het
Or2w3b G A 11: 58,623,295 (GRCm39) A232V probably benign Het
Or2w3b T C 11: 58,623,475 (GRCm39) H172R probably benign Het
Or2w3b C A 11: 58,624,048 (GRCm39) probably benign Het
Or2w3b T G 11: 58,623,200 (GRCm39) N264H probably benign Het
Or5af2 T C 11: 58,708,122 (GRCm39) V96A probably benign Het
Or5af2 A C 11: 58,708,220 (GRCm39) I129L probably benign Het
Or5af2 T C 11: 58,708,508 (GRCm39) C225R probably benign Het
Or5af2 C G 11: 58,708,644 (GRCm39) P270R probably benign Het
Or5af2 A G 11: 58,707,887 (GRCm39) I18V probably benign Het
Or6k2 C A 1: 173,986,907 (GRCm39) C189* probably null Het
Or9e1 G T 11: 58,731,945 (GRCm39) A2S probably benign Het
Or9e1 G C 11: 58,731,907 (GRCm39) probably benign Het
Or9e1 C T 11: 58,732,032 (GRCm39) L31F probably benign Het
Or9e1 G A 11: 58,732,569 (GRCm39) A210T probably benign Het
Or9e1 A G 11: 58,732,615 (GRCm39) H225R probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Ovca2 T C 11: 75,069,528 (GRCm39) T32A probably benign Het
Pimreg G A 11: 71,935,979 (GRCm39) R154H probably damaging Het
Pimreg TCACA TCA 11: 71,935,801 (GRCm39) probably benign Het
Pitpnm3 C T 11: 72,010,969 (GRCm39) R21Q probably benign Het
Pitpnm3 T C 11: 71,954,955 (GRCm39) K520E probably benign Het
Ppp1r12b C G 1: 134,883,262 (GRCm39) V87L probably benign Het
Prpsap2 A C 11: 61,647,078 (GRCm39) V21G possibly damaging Het
Psrc1 C A 3: 108,293,873 (GRCm39) S230* probably null Het
Rabep1 C CT 11: 70,830,910 (GRCm39) probably null Het
Rai1 A G 11: 60,078,389 (GRCm39) N818D probably benign Het
Rap1gap2 C T 11: 74,487,721 (GRCm39) E52K probably benign Het
Rc3h2 G A 2: 37,299,568 (GRCm39) A154V possibly damaging Het
Rc3h2 T C 2: 37,289,612 (GRCm39) H400R possibly damaging Het
Rnf112 A G 11: 61,341,775 (GRCm39) L343P unknown Het
Rnf167 C CACAGGGA 11: 70,541,646 (GRCm39) probably null Het
Rtn3 G C 19: 7,460,342 (GRCm39) P36R unknown Het
Rtn4rl1 C T 11: 75,156,863 (GRCm39) P432S probably benign Het
Slc41a1 A G 1: 131,767,972 (GRCm39) M179V probably benign Het
Slc6a4 A G 11: 76,903,858 (GRCm39) K152R probably benign Het
Slc6a4 G A 11: 76,901,382 (GRCm39) G39E probably benign Het
Smcr8 T C 11: 60,669,932 (GRCm39) V360A probably benign Het
Smcr8 A G 11: 60,668,806 (GRCm39) probably benign Het
Smcr8 C A 11: 60,670,699 (GRCm39) R616S probably benign Het
Smg6 G T 11: 75,047,092 (GRCm39) A1262S probably benign Het
Spink12 G A 18: 44,237,775 (GRCm39) A18T probably benign Het
Spns3 G A 11: 72,440,917 (GRCm39) P40S probably benign Het
Spns3 T C 11: 72,440,863 (GRCm39) I58V probably benign Het
Spns3 T C 11: 72,440,986 (GRCm39) S17G probably benign Het
Srebf1 C T 11: 60,097,061 (GRCm39) V256M probably benign Het
Tekt1 T C 11: 72,250,597 (GRCm39) Q33R probably benign Het
Timm22 T G 11: 76,297,943 (GRCm39) V18G probably benign Het
Tmem102 G C 11: 69,695,927 (GRCm39) R45G probably benign Het
Tmem102 C G 11: 69,695,902 (GRCm39) G53A possibly damaging Het
Tmem11 A G 11: 60,766,658 (GRCm39) probably benign Het
Tom1l2 C T 11: 60,132,682 (GRCm39) A414T probably benign Het
Top3a C T 11: 60,641,410 (GRCm39) G425S probably benign Het
Trim16 A AAGC 11: 62,711,521 (GRCm39) probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,711,516 (GRCm39) probably benign Het
Trim16 G C 11: 62,711,502 (GRCm39) V58L probably benign Het
Trim16 C T 11: 62,711,428 (GRCm39) A33V probably benign Het
Trim16 C A 11: 62,731,675 (GRCm39) D515E probably benign Het
Trim16 T C 11: 62,731,572 (GRCm39) V481A probably benign Het
Trim16 G A 11: 62,727,643 (GRCm39) E322K probably benign Het
Trim17 G A 11: 58,856,331 (GRCm39) M129I probably benign Het
Trim17 A G 11: 58,861,272 (GRCm39) N259S probably benign Het
Trim58 C A 11: 58,531,684 (GRCm39) L131M possibly damaging Het
Trim58 A G 11: 58,542,486 (GRCm39) N482S probably benign Het
Trmt1l A G 1: 151,333,331 (GRCm39) N642S possibly damaging Het
Trpv1 C G 11: 73,131,427 (GRCm39) P322A possibly damaging Het
Trpv1 C A 11: 73,145,117 (GRCm39) D734E probably benign Het
Trpv3 G A 11: 73,169,803 (GRCm39) A125T probably benign Het
Trpv3 C T 11: 73,160,513 (GRCm39) A9V probably benign Het
Trpv3 A G 11: 73,174,502 (GRCm39) T290A probably benign Het
Tvp23b A C 11: 62,772,769 (GRCm39) N7H possibly damaging Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,746,545 (GRCm39) probably benign Het
Usp43 C T 11: 67,747,332 (GRCm39) G792S probably benign Het
Utrn C T 10: 12,545,491 (GRCm39) R1718H probably damaging Het
Vamp2 C T 11: 68,979,411 (GRCm39) probably benign Het
Vamp2 G A 11: 68,980,889 (GRCm39) G124R possibly damaging Het
Wdr4 C T 17: 31,731,177 (GRCm39) G61E probably damaging Het
Xaf1 GCT GCTGGCCACCT 11: 72,199,847 (GRCm39) probably null Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,199,846 (GRCm39) probably null Het
Xaf1 T G 11: 72,199,792 (GRCm39) C176W unknown Het
Xaf1 A G 11: 72,199,476 (GRCm39) E71G probably benign Het
Xaf1 C A 11: 72,197,434 (GRCm39) L137I probably benign Het
Xaf1 G C 11: 72,197,429 (GRCm39) C135S probably damaging Het
Xaf1 G A 11: 72,197,426 (GRCm39) R134H probably benign Het
Xaf1 T C 11: 72,199,881 (GRCm39) L206S unknown Het
Xaf1 G C 11: 72,199,856 (GRCm39) V198L unknown Het
Xaf1 T TGGCCAGCA 11: 72,199,849 (GRCm39) probably null Het
Zfp286 G A 11: 62,675,782 (GRCm39) T60M probably damaging Het
Zfp286 A G 11: 62,678,795 (GRCm39) V44A probably benign Het
Zfp287 C G 11: 62,606,175 (GRCm39) C244S probably benign Het
Zfp287 G A 11: 62,613,757 (GRCm39) R225* probably null Het
Zfp287 C T 11: 62,604,633 (GRCm39) R758H probably benign Het
Zfp39 T C 11: 58,781,526 (GRCm39) N412S possibly damaging Het
Zfp39 T C 11: 58,781,274 (GRCm39) D496G possibly damaging Het
Zfp39 G C 11: 58,781,273 (GRCm39) D496E probably benign Het
Zfp39 G C 11: 58,781,130 (GRCm39) T544R possibly damaging Het
Zfp39 A C 11: 58,780,873 (GRCm39) Y630D probably benign Het
Zfp39 G C 11: 58,780,871 (GRCm39) Y630* probably null Het
Zfp39 T G 11: 58,791,409 (GRCm39) S93R probably benign Het
Zfp39 G T 11: 58,791,407 (GRCm39) S93R probably benign Het
Zfp39 T C 11: 58,782,142 (GRCm39) K207E probably benign Het
Zfp39 G T 11: 58,781,597 (GRCm39) N388K probably benign Het
Zfp39 A G 11: 58,781,605 (GRCm39) S386P probably benign Het
Zfp39 A G 11: 58,781,724 (GRCm39) V346A probably benign Het
Zfp39 T A 11: 58,781,751 (GRCm39) K337M probably benign Het
Zfp39 T A 11: 58,781,967 (GRCm39) H265L probably damaging Het
Zfp39 A G 11: 58,782,123 (GRCm39) I213T probably benign Het
Zfp672 G T 11: 58,220,452 (GRCm39) T49K unknown Het
Zfp692 G T 11: 58,199,859 (GRCm39) E149D probably benign Het
Zfp692 G A 11: 58,200,844 (GRCm39) V242I probably benign Het
Zfpm1 C A 8: 123,060,612 (GRCm39) L234M probably damaging Het
Zzef1 G A 11: 72,780,008 (GRCm39) R1927H probably benign Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,732,064 (GRCm39) splice site probably benign
IGL00805:Dnah9 APN 11 65,772,521 (GRCm39) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,880,768 (GRCm39) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,740,806 (GRCm39) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 65,962,882 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 65,971,397 (GRCm39) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,046,285 (GRCm39) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,846,543 (GRCm39) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,838,506 (GRCm39) missense probably benign
IGL01565:Dnah9 APN 11 65,924,655 (GRCm39) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,009,656 (GRCm39) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,722,441 (GRCm39) nonsense probably null
IGL01625:Dnah9 APN 11 65,935,471 (GRCm39) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,009,655 (GRCm39) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 65,998,952 (GRCm39) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,021,492 (GRCm39) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 65,965,860 (GRCm39) splice site probably benign
IGL01923:Dnah9 APN 11 66,016,061 (GRCm39) splice site probably benign
IGL02059:Dnah9 APN 11 65,963,784 (GRCm39) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 65,951,871 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,008,318 (GRCm39) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,818,526 (GRCm39) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 65,971,314 (GRCm39) splice site probably benign
IGL02325:Dnah9 APN 11 65,725,043 (GRCm39) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,015,979 (GRCm39) missense probably benign
IGL02440:Dnah9 APN 11 65,846,072 (GRCm39) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,838,444 (GRCm39) nonsense probably null
IGL02496:Dnah9 APN 11 65,920,189 (GRCm39) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,818,427 (GRCm39) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,777,466 (GRCm39) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 65,931,172 (GRCm39) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 65,928,570 (GRCm39) splice site probably benign
IGL02859:Dnah9 APN 11 65,772,445 (GRCm39) splice site probably benign
IGL02864:Dnah9 APN 11 65,951,829 (GRCm39) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,009,793 (GRCm39) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,732,099 (GRCm39) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,746,098 (GRCm39) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 65,998,880 (GRCm39) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,872,067 (GRCm39) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,777,465 (GRCm39) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,838,368 (GRCm39) missense probably damaging 1.00
anarchy UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
sacco UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
Tweed UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
vanzetti UTSW 11 65,746,198 (GRCm39) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 65,895,839 (GRCm39) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0070:Dnah9 UTSW 11 66,050,866 (GRCm39) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0180:Dnah9 UTSW 11 66,038,116 (GRCm39) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,746,141 (GRCm39) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,802,678 (GRCm39) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,802,615 (GRCm39) critical splice donor site probably null
R0288:Dnah9 UTSW 11 65,915,960 (GRCm39) critical splice donor site probably null
R0309:Dnah9 UTSW 11 65,917,798 (GRCm39) splice site probably benign
R0356:Dnah9 UTSW 11 66,021,388 (GRCm39) critical splice donor site probably null
R0403:Dnah9 UTSW 11 65,975,615 (GRCm39) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 65,998,961 (GRCm39) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,809,539 (GRCm39) splice site probably benign
R0496:Dnah9 UTSW 11 65,965,961 (GRCm39) missense probably null 1.00
R0557:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,881,315 (GRCm39) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,009,703 (GRCm39) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,856,515 (GRCm39) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,732,159 (GRCm39) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 65,976,284 (GRCm39) missense probably benign 0.01
R0715:Dnah9 UTSW 11 65,972,074 (GRCm39) splice site probably benign
R0726:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R0737:Dnah9 UTSW 11 65,998,724 (GRCm39) missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66,046,356 (GRCm39) missense probably benign 0.30
R0792:Dnah9 UTSW 11 65,786,827 (GRCm39) missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 65,896,002 (GRCm39) missense probably benign 0.00
R0973:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R0974:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R1055:Dnah9 UTSW 11 66,050,837 (GRCm39) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 65,975,703 (GRCm39) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 65,975,438 (GRCm39) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,761,886 (GRCm39) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,818,414 (GRCm39) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,846,573 (GRCm39) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,764,958 (GRCm39) missense probably benign 0.22
R1447:Dnah9 UTSW 11 65,999,308 (GRCm39) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,818,612 (GRCm39) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,725,098 (GRCm39) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,772,587 (GRCm39) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,003,156 (GRCm39) missense probably benign
R1617:Dnah9 UTSW 11 65,786,747 (GRCm39) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 65,928,463 (GRCm39) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 65,976,093 (GRCm39) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,818,789 (GRCm39) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,845,650 (GRCm39) nonsense probably null
R1701:Dnah9 UTSW 11 65,802,750 (GRCm39) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 65,976,021 (GRCm39) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,805,980 (GRCm39) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,872,048 (GRCm39) missense probably benign 0.31
R1784:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66,010,420 (GRCm39) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,846,123 (GRCm39) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,740,887 (GRCm39) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,009,667 (GRCm39) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,725,024 (GRCm39) nonsense probably null
R1847:Dnah9 UTSW 11 65,725,212 (GRCm39) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 65,928,316 (GRCm39) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,867,224 (GRCm39) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,846,164 (GRCm39) missense probably benign 0.11
R2049:Dnah9 UTSW 11 65,935,509 (GRCm39) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,036,261 (GRCm39) missense probably benign 0.31
R2104:Dnah9 UTSW 11 65,951,950 (GRCm39) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 65,928,411 (GRCm39) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,008,309 (GRCm39) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 65,963,605 (GRCm39) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,750,325 (GRCm39) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2396:Dnah9 UTSW 11 65,975,984 (GRCm39) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,806,029 (GRCm39) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2419:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2510:Dnah9 UTSW 11 65,895,995 (GRCm39) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 65,924,751 (GRCm39) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,059,287 (GRCm39) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,008,414 (GRCm39) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3433:Dnah9 UTSW 11 65,965,938 (GRCm39) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,047,734 (GRCm39) nonsense probably null
R3820:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3861:Dnah9 UTSW 11 65,943,820 (GRCm39) splice site probably benign
R3918:Dnah9 UTSW 11 65,761,800 (GRCm39) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,725,290 (GRCm39) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,024,461 (GRCm39) missense probably benign 0.03
R4072:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4076:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,881,285 (GRCm39) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,872,040 (GRCm39) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,009,575 (GRCm39) missense probably benign 0.00
R4434:Dnah9 UTSW 11 65,998,901 (GRCm39) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,772,467 (GRCm39) missense probably benign 0.07
R4452:Dnah9 UTSW 11 65,917,908 (GRCm39) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,038,215 (GRCm39) missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 65,931,218 (GRCm39) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,058,978 (GRCm39) missense probably benign
R4655:Dnah9 UTSW 11 65,846,558 (GRCm39) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,046,357 (GRCm39) missense probably benign
R4718:Dnah9 UTSW 11 65,976,299 (GRCm39) missense probably benign
R4720:Dnah9 UTSW 11 65,967,184 (GRCm39) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,818,552 (GRCm39) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,764,950 (GRCm39) nonsense probably null
R4963:Dnah9 UTSW 11 65,975,437 (GRCm39) splice site probably null
R5074:Dnah9 UTSW 11 65,740,866 (GRCm39) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,003,159 (GRCm39) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,772,522 (GRCm39) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 65,920,180 (GRCm39) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 65,920,182 (GRCm39) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 65,986,140 (GRCm39) nonsense probably null
R5541:Dnah9 UTSW 11 66,036,162 (GRCm39) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,772,566 (GRCm39) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,724,922 (GRCm39) splice site probably null
R5648:Dnah9 UTSW 11 65,818,581 (GRCm39) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,740,806 (GRCm39) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 65,916,049 (GRCm39) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,846,065 (GRCm39) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,017,427 (GRCm39) missense probably benign 0.01
R5831:Dnah9 UTSW 11 65,998,947 (GRCm39) missense probably benign 0.00
R5847:Dnah9 UTSW 11 65,986,066 (GRCm39) frame shift probably null
R5870:Dnah9 UTSW 11 65,976,036 (GRCm39) missense probably benign 0.01
R5902:Dnah9 UTSW 11 65,916,013 (GRCm39) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,725,025 (GRCm39) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,725,307 (GRCm39) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,036,223 (GRCm39) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.05
R6086:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
R6086:Dnah9 UTSW 11 65,880,741 (GRCm39) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,881,342 (GRCm39) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,038,225 (GRCm39) missense probably benign
R6154:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,772,631 (GRCm39) splice site probably null
R6265:Dnah9 UTSW 11 66,058,920 (GRCm39) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,732,201 (GRCm39) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 65,928,519 (GRCm39) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,059,107 (GRCm39) missense probably benign 0.37
R6582:Dnah9 UTSW 11 65,951,923 (GRCm39) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,846,192 (GRCm39) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 65,963,565 (GRCm39) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,872,155 (GRCm39) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,008,452 (GRCm39) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 65,975,975 (GRCm39) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 65,967,167 (GRCm39) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 65,998,735 (GRCm39) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,872,057 (GRCm39) missense probably benign
R7161:Dnah9 UTSW 11 65,746,198 (GRCm39) nonsense probably null
R7175:Dnah9 UTSW 11 66,024,463 (GRCm39) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,009,770 (GRCm39) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,856,473 (GRCm39) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,881,302 (GRCm39) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,880,677 (GRCm39) missense probably benign 0.00
R7350:Dnah9 UTSW 11 65,971,404 (GRCm39) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,008,233 (GRCm39) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,846,045 (GRCm39) missense probably benign
R7477:Dnah9 UTSW 11 65,883,557 (GRCm39) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,732,240 (GRCm39) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,880,663 (GRCm39) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,016,041 (GRCm39) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,880,606 (GRCm39) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,009,784 (GRCm39) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,802,656 (GRCm39) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,740,839 (GRCm39) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 65,896,631 (GRCm39) nonsense probably null
R7814:Dnah9 UTSW 11 65,896,486 (GRCm39) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 65,916,037 (GRCm39) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,732,227 (GRCm39) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 65,908,201 (GRCm39) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,746,149 (GRCm39) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,880,644 (GRCm39) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,008,452 (GRCm39) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,732,067 (GRCm39) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,722,556 (GRCm39) missense probably benign 0.00
R8721:Dnah9 UTSW 11 65,986,124 (GRCm39) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,818,816 (GRCm39) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,796,057 (GRCm39) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,750,309 (GRCm39) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,740,742 (GRCm39) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,746,060 (GRCm39) missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 65,943,840 (GRCm39) missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65,746,210 (GRCm39) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,802,747 (GRCm39) missense probably benign
R8933:Dnah9 UTSW 11 65,746,078 (GRCm39) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,059,226 (GRCm39) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,015,938 (GRCm39) critical splice donor site probably null
R8979:Dnah9 UTSW 11 65,895,978 (GRCm39) missense probably benign
R8991:Dnah9 UTSW 11 65,777,506 (GRCm39) missense probably damaging 0.96
R9016:Dnah9 UTSW 11 65,998,856 (GRCm39) missense probably damaging 0.99
R9025:Dnah9 UTSW 11 65,896,651 (GRCm39) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,845,680 (GRCm39) missense
R9047:Dnah9 UTSW 11 65,962,925 (GRCm39) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,008,464 (GRCm39) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,880,713 (GRCm39) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,021,457 (GRCm39) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 65,895,972 (GRCm39) missense probably benign
R9198:Dnah9 UTSW 11 65,846,570 (GRCm39) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,746,113 (GRCm39) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 65,924,751 (GRCm39) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,732,081 (GRCm39) missense probably benign 0.01
R9307:Dnah9 UTSW 11 65,976,300 (GRCm39) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,761,775 (GRCm39) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,838,368 (GRCm39) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,739,199 (GRCm39) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,725,089 (GRCm39) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 65,976,309 (GRCm39) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,867,347 (GRCm39) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 65,999,217 (GRCm39) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,818,475 (GRCm39) missense probably benign 0.00
R9748:Dnah9 UTSW 11 65,976,290 (GRCm39) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 65,986,202 (GRCm39) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 65,965,944 (GRCm39) missense probably null 0.93
R9784:Dnah9 UTSW 11 65,975,960 (GRCm39) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,860,902 (GRCm39) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 65,976,305 (GRCm39) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,881,278 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,860,910 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,818,679 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,786,798 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,963,661 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,928,300 (GRCm39) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,017,476 (GRCm39) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1186:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Predicted Primers
Posted On 2021-03-08