Incidental Mutation 'Z1192:Itgae'
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #Z1192 ()
Quality Score221.999
Status Not validated
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 73134127 bp
Amino Acid Change Serine to Tryptophan at position 1028 (S1028W)
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947

signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052140
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107

low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102537
AA Change: S1028W

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: S1028W

signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 386 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik T A 11: 65,152,968 Q89L unknown Het
1700086D15Rik A C 11: 65,152,983 V84G unknown Het
1700086D15Rik A G 11: 65,153,254 F38S unknown Het
1700086D15Rik A G 11: 65,153,288 W27R unknown Het
1700086D15Rik A G 11: 65,153,302 L22P unknown Het
1810065E05Rik C T 11: 58,422,201 L27F probably benign Het
1810065E05Rik C T 11: 58,422,234 L38F possibly damaging Het
1810065E05Rik C T 11: 58,425,799 L202F probably benign Het
2210407C18Rik G A 11: 58,608,509 P161L probably benign Het
2210407C18Rik A G 11: 58,612,561 L47P probably benign Het
2210407C18Rik T G 11: 58,612,571 S44R probably benign Het
2810021J22Rik C T 11: 58,880,535 A281V probably benign Het
4930438A08Rik A G 11: 58,294,018 T521A unknown Het
4933427D14Rik G A 11: 72,176,709 T585I possibly damaging Het
4933427D14Rik G T 11: 72,189,616 P408H probably damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,195,712 probably null Het
4933427D14Rik A G 11: 72,195,743 C281R possibly damaging Het
4933427D14Rik T G 11: 72,195,754 K277T probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,195,764 probably null Het
4933427D14Rik T C 11: 72,195,769 Q272R probably damaging Het
4933427D14Rik G A 11: 72,198,482 P192L probably benign Het
4933427D14Rik C A 11: 72,198,534 A175S probably benign Het
4933427D14Rik T G 11: 72,198,924 S45R probably damaging Het
Adgra3 G A 5: 49,999,281 T369I probably benign Het
Akap10 T A 11: 61,915,270 S211C probably benign Het
Alox8 C T 11: 69,186,047 R536Q probably benign Het
Alox8 A G 11: 69,197,496 V76A probably benign Het
Aloxe3 A G 11: 69,128,675 Q138R probably benign Het
Aloxe3 C T 11: 69,148,603 A667V probably benign Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Arsk G T 13: 76,098,518 probably benign Het
Aspa G T 11: 73,322,187 L110I probably benign Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
Aurkb C T 11: 69,047,866 R44W probably damaging Het
Aurkb T C 11: 69,047,870 F45S probably benign Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
B9d1 A T 11: 61,505,203 probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Borcs6 G A 11: 69,060,627 R277Q possibly damaging Het
Btbd3 ATCGGGGTCG ATCG 2: 138,284,090 probably benign Het
Btnl10 T C 11: 58,919,312 V93A probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,923,927 probably benign Het
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Het
Btnl10 A AAGC 11: 58,923,931 probably benign Het
Btnl10 C T 11: 58,926,824 T250I unknown Het
Btnl9 C T 11: 49,175,978 R272H unknown Het
Camsap3 G T 8: 3,604,124 R598L probably damaging Het
Ccdc42 C T 11: 68,587,191 probably benign Het
Ccdc92b A G 11: 74,630,054 M61V possibly damaging Het
Chd3 C A 11: 69,348,445 E1753D probably benign Het
Chd3 A G 11: 69,361,451 W42R probably benign Het
Cluh AGCCTG AGCCTGGGCCTG 11: 74,669,525 probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cntrob C T 11: 69,305,578 R677H probably benign Het
Cntrob G A 11: 69,308,056 P622L probably benign Het
Cyb5d1 A G 11: 69,395,202 L31P probably benign Het
Cyb5d1 C A 11: 69,395,272 A8S probably benign Het
Dach1 G A 14: 97,903,151 P524S probably benign Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnah9 G A 11: 66,147,381 H110Y probably benign Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Eif2b5 C T 16: 20,498,921 A3V unknown Het
Elac2 T C 11: 64,979,189 S27P probably benign Het
Epn2 C A 11: 61,579,634 probably benign Het
Fam114a2 A G 11: 57,484,032 S494P probably benign Het
Fam114a2 G A 11: 57,490,114 A438V probably benign Het
Fam114a2 C T 11: 57,499,755 V318I probably benign Het
Fam114a2 T C 11: 57,499,797 N304D probably benign Het
Fam114a2 C T 11: 57,514,234 G14E probably benign Het
Fam83g G A 11: 61,703,194 R518Q probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,308,970 probably null Het
Fat2 T G 11: 55,309,799 K816N probably benign Het
Fbxw10 G C 11: 62,847,292 R4T probably benign Het
Fbxw10 G A 11: 62,876,845 V836I probably benign Het
Galnt10 G A 11: 57,765,688 V233I probably benign Het
Gemin5 C G 11: 58,122,289 S1446T probably benign Het
Gemin5 T C 11: 58,125,218 S1321G probably benign Het
Gemin5 T C 11: 58,130,071 M1097V probably benign Het
Gemin5 C G 11: 58,139,510 A830P probably benign Het
Gemin5 C G 11: 58,139,575 C808S probably benign Het
Gemin5 C G 11: 58,146,519 E623D probably benign Het
Ggnbp2 C T 11: 84,836,652 R481Q probably benign Het
Gjc2 A G 11: 59,176,492 V388A unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,182,735 probably benign Het
Glod4 C A 11: 76,242,993 probably null Het
Glod4 A G 11: 76,243,010 V6A probably benign Het
Glod4 T C 11: 76,243,604 K14R probably benign Het
Glod4 T C 11: 76,243,605 K14E probably benign Het
Glp2r C A 11: 67,709,568 R485L probably damaging Het
Glp2r C A 11: 67,709,644 V460F probably benign Het
Glp2r C G 11: 67,709,646 G459A probably benign Het
Glp2r A G 11: 67,741,052 V283A probably benign Het
Glp2r T C 11: 67,741,059 I281V probably benign Het
Glp2r T C 11: 67,742,303 T235A probably benign Het
Glp2r A G 11: 67,744,947 V189A probably benign Het
Glp2r C A 11: 67,770,836 A13S probably benign Het
Gm12253 G C 11: 58,434,541 S13T possibly damaging Het
Gm12253 A G 11: 58,434,832 E43G probably benign Het
Gm12253 A C 11: 58,434,860 E52D probably benign Het
Gm12253 A C 11: 58,435,411 E84A probably benign Het
Gm12253 G A 11: 58,435,483 S108N probably benign Het
Gm12253 G A 11: 58,441,009 A215T possibly damaging Het
Gm12258 T G 11: 58,858,300 S100R Het
Gm12258 C T 11: 58,858,436 R146W Het
Gm12258 G A 11: 58,858,938 R313H unknown Het
Gm12258 G A 11: 58,858,950 G317E unknown Het
Gm12258 A T 11: 58,859,007 E336V unknown Het
Gm12258 A G 11: 58,859,187 probably benign Het
Gm12258 T A 11: 58,859,188 probably benign Het
Gm12258 G C 11: 58,859,864 G622R unknown Het
Gps2 C T 11: 69,916,304 A60V probably benign Het
Gucy2e C A 11: 69,223,605 A1033S probably benign Het
Gucy2e C G 11: 69,236,603 G15R unknown Het
Haspin T C 11: 73,137,348 Q305R probably benign Het
Haspin A G 11: 73,137,951 L104P probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hic1 G A 11: 75,167,526 T179M probably damaging Het
Hic1 GGGAGG GGG 11: 75,169,450 probably benign Het
Iba57 CAGA CAGAGA 11: 59,161,503 probably null Het
Iba57 T C 11: 59,161,555 T87A unknown Het
Iba57 T C 11: 59,161,558 T86A unknown Het
Iba57 C G 11: 59,163,039 G36R unknown Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Igtp T G 11: 58,206,343 D113E probably damaging Het
Igtp C G 11: 58,206,965 L321V possibly damaging Het
Igtp C G 11: 58,207,118 L372V probably benign Het
Ihh G C 1: 74,951,045 P57R probably damaging Het
Insrr T C 3: 87,802,579 C280R probably damaging Het
Irgm2 T A 11: 58,219,513 V10D probably benign Het
Irgm2 A G 11: 58,219,563 N27D probably benign Het
Irgm2 T C 11: 58,219,912 I143T probably benign Het
Irgm2 T C 11: 58,219,954 L157S probably benign Het
Irgm2 G A 11: 58,220,007 V175I probably benign Het
Irgm2 G A 11: 58,220,098 S205N probably benign Het
Irgm2 A C 11: 58,220,125 H214P probably benign Het
Irgm2 G T 11: 58,220,412 A310S possibly damaging Het
Irgm2 C G 11: 58,220,563 T360S probably benign Het
Kif1c C T 11: 70,724,114 P578L probably benign Het
Kmt2d T C 15: 98,851,744 N2656D unknown Het
Larp1 G A 11: 58,042,340 V257I probably benign Het
Lypd8 T C 11: 58,382,775 Y27H probably benign Het
Lypd8 C A 11: 58,384,649 A70E possibly damaging Het
Lypd8 G A 11: 58,384,663 E75K probably benign Het
Maml3 A T 3: 51,855,744 L600M probably damaging Het
Mfap3 A T 11: 57,528,040 I9F possibly damaging Het
Mfap3 G A 11: 57,528,076 G21S probably benign Het
Mrm3 G A 11: 76,244,077 R102K probably benign Het
Mrm3 C T 11: 76,247,395 P203L probably benign Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mrpl22 G A 11: 58,171,695 A4T unknown Het
Mrpl55 A G 11: 59,204,173 probably null Het
Mrpl55 A T 11: 59,204,589 L26F probably benign Het
Myh7 A T 14: 54,983,291 V1017D probably damaging Het
Myocd A G 11: 65,184,592 S697P probably benign Het
Nlgn2 A G 11: 69,828,394 V210A possibly damaging Het
Nlrp1a T C 11: 71,092,243 K1299R probably benign Het
Nlrp1a C T 11: 71,097,251 R1131Q probably damaging Het
Nlrp1a T C 11: 71,099,616 I1038V probably benign Het
Nlrp1a T C 11: 71,124,088 E112G probably benign Het
Nlrp1a C G 11: 71,142,529 probably null Het
Nlrp1b C A 11: 71,181,708 M436I probably benign Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Nlrp1b A G 11: 71,182,322 Y232H probably benign Het
Nlrp1b A T 11: 71,182,440 D192E probably benign Het
Nlrp1b T C 11: 71,182,454 T188A probably benign Het
Nlrp1b C G 11: 71,182,544 E158Q probably benign Het
Nlrp1b A T 11: 71,182,552 M155K probably benign Het
Nlrp1b T A 11: 71,182,570 Q149L probably benign Het
Nlrp1b T C 11: 71,182,677 I113M probably benign Het
Nmur2 T C 11: 56,040,278 I202M probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Nsun6 C T 2: 15,038,107 R181H probably damaging Het
Obscn G A 11: 59,000,889 A6939V probably benign Het
Obscn C G 11: 59,009,193 G938A probably benign Het
Obscn G C 11: 59,013,188 T7320S probably benign Het
Obscn C T 11: 59,031,108 R5954Q probably damaging Het
Obscn G C 11: 59,039,150 P5080A probably benign Het
Obscn T A 11: 59,039,164 Q5075L probably damaging Het
Obscn T C 11: 59,041,775 I4869V probably benign Het
Obscn T C 11: 59,042,950 T5363A probably benign Het
Obscn G A 11: 59,043,027 A5337V probably benign Het
Obscn G A 11: 59,043,052 R5329C probably benign Het
Obscn C T 11: 59,049,480 D5354N Het
Obscn C A 11: 59,049,788 R4593S possibly damaging Het
Obscn T C 11: 59,049,797 T5307A Het
Obscn G A 11: 59,051,557 T4372M probably benign Het
Obscn T C 11: 59,052,613 M4237V probably benign Het
Obscn C T 11: 59,053,768 R4700Q probably benign Het
Obscn T C 11: 59,053,825 K4681R probably benign Het
Obscn T C 11: 59,054,218 E4658G probably benign Het
Obscn C T 11: 59,054,350 R4614Q probably benign Het
Obscn T C 11: 59,055,505 D4458G probably damaging Het
Obscn C T 11: 59,055,514 R4455K probably benign Het
Obscn G T 11: 59,056,110 A4066E possibly damaging Het
Obscn A G 11: 59,056,769 M4478T Het
Obscn C T 11: 59,061,562 G3894R probably benign Het
Obscn T C 11: 59,063,576 K3727E probably damaging Het
Obscn G A 11: 59,067,147 R3576C probably benign Het
Obscn C T 11: 59,067,829 V3433I probably benign Het
Obscn C A 11: 59,069,931 A3185S probably benign Het
Obscn C T 11: 59,076,508 V2792I possibly damaging Het
Obscn G A 11: 59,079,158 R53C probably damaging Het
Obscn C G 11: 59,079,896 V2328L probably benign Het
Obscn C A 11: 59,081,872 G2116V possibly damaging Het
Obscn C T 11: 59,086,679 R1865H probably benign Het
Obscn T C 11: 59,086,701 R1858G probably benign Het
Obscn A G 11: 59,086,739 V1845A probably benign Het
Obscn A G 11: 59,093,316 F1771S probably benign Het
Obscn C T 11: 59,093,413 V1739M possibly damaging Het
Obscn G T 11: 59,093,508 A1707D possibly damaging Het
Obscn C T 11: 59,093,509 A1707T probably benign Het
Obscn G A 11: 59,093,559 A1690V probably benign Het
Obscn C T 11: 59,099,909 A1613T possibly damaging Het
Obscn T C 11: 59,099,929 H1606R probably benign Het
Obscn C G 11: 59,103,341 A1572P probably damaging Het
Obscn G A 11: 59,103,538 A1506V probably benign Het
Obscn T C 11: 59,112,554 E1306G probably benign Het
Obscn T C 11: 59,122,737 M1095V probably benign Het
Obscn C T 11: 59,128,066 A949T probably benign Het
Obscn C T 11: 59,128,069 V973M probably damaging Het
Obscn C T 11: 59,130,623 R797H probably damaging Het
Obscn C T 11: 59,133,111 A578T possibly damaging Het
Obscn G A 11: 59,133,240 P535S probably damaging Het
Obscn C G 11: 59,133,246 A533P probably benign Het
Obscn T C 11: 59,135,679 I233V probably benign Het
Olfr224 G A 11: 58,566,562 A261V probably benign Het
Olfr224 A T 11: 58,566,695 S217T probably benign Het
Olfr224 C T 11: 58,567,094 V84I probably benign Het
Olfr311 G C 11: 58,841,081 probably benign Het
Olfr311 G T 11: 58,841,119 A2S probably benign Het
Olfr311 C T 11: 58,841,206 L31F probably benign Het
Olfr311 G A 11: 58,841,743 A210T probably benign Het
Olfr311 A G 11: 58,841,789 H225R probably benign Het
Olfr313 A G 11: 58,817,061 I18V probably benign Het
Olfr313 T C 11: 58,817,296 V96A probably benign Het
Olfr313 A C 11: 58,817,394 I129L probably benign Het
Olfr313 T C 11: 58,817,682 C225R probably benign Het
Olfr313 C G 11: 58,817,818 P270R probably benign Het
Olfr314 A G 11: 58,786,947 T238A probably damaging Het
Olfr316 G A 11: 58,757,967 A101T probably benign Het
Olfr316 C T 11: 58,758,069 L135F probably benign Het
Olfr316 A G 11: 58,758,105 S147G probably benign Het
Olfr316 G A 11: 58,758,327 V221M probably damaging Het
Olfr316 A C 11: 58,758,342 I226L probably benign Het
Olfr316 A C 11: 58,758,360 K232Q probably benign Het
Olfr317 T G 11: 58,732,374 N264H probably benign Het
Olfr317 G A 11: 58,732,469 A232V probably benign Het
Olfr317 T C 11: 58,732,649 H172R probably benign Het
Olfr317 C A 11: 58,733,222 probably benign Het
Olfr318 G A 11: 58,721,096 probably benign Het
Olfr319 A C 11: 58,701,958 I86L probably benign Het
Olfr319 C T 11: 58,702,327 L209F possibly damaging Het
Olfr319 C A 11: 58,702,396 Q232K probably benign Het
Olfr320 G T 11: 58,683,932 D20Y probably benign Het
Olfr320 T C 11: 58,683,989 F39L probably benign Het
Olfr320 G A 11: 58,684,257 R128Q probably benign Het
Olfr320 C T 11: 58,684,463 H197Y probably benign Het
Olfr322 T G 11: 58,666,516 I319R probably benign Het
Olfr323 G A 11: 58,625,249 S79F probably benign Het
Olfr323 C G 11: 58,625,304 G61R probably benign Het
Olfr323 G A 11: 58,625,762 P95S probably benign Het
Olfr323 T G 11: 58,625,793 K84N probably benign Het
Olfr323 A C 11: 58,625,906 C46G possibly damaging Het
Olfr324 A C 11: 58,597,518 I35L probably benign Het
Olfr324 A G 11: 58,597,530 I39V probably benign Het
Olfr324 A G 11: 58,597,665 S84G possibly damaging Het
Olfr324 A G 11: 58,597,950 S179G probably benign Het
Olfr325 C T 11: 58,580,924 H27Y probably benign Het
Olfr325 T C 11: 58,580,931 V29A probably benign Het
Olfr325 T G 11: 58,581,296 L151V probably benign Het
Olfr325 G C 11: 58,581,657 S271T probably benign Het
Olfr328 T C 11: 58,551,561 K226R probably benign Het
Olfr328 C T 11: 58,551,975 S88N probably benign Het
Olfr328 C T 11: 58,552,114 A42T probably benign Het
Olfr329-ps G T 11: 58,543,446 S23Y probably benign Het
Olfr331 GAGGTGGATTGGTA GA 11: 58,502,384 probably benign Het
Olfr331 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,502,386 probably benign Het
Olfr331 C G 11: 58,502,461 V38L probably benign Het
Olfr331 C T 11: 58,502,570 M1I probably null Het
Olfr332 C A 11: 58,489,748 E336* probably null Het
Olfr332 C T 11: 58,490,297 A153T probably benign Het
Olfr332 T C 11: 58,490,488 Q89R probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ovca2 T C 11: 75,178,702 T32A probably benign Het
Pimreg TCACA TCA 11: 72,044,975 probably benign Het
Pimreg G A 11: 72,045,153 R154H probably damaging Het
Pitpnm3 T C 11: 72,064,129 K520E probably benign Het
Pitpnm3 C T 11: 72,120,143 R21Q probably benign Het
Ppp1r12b C G 1: 134,955,524 V87L probably benign Het
Prpsap2 A C 11: 61,756,252 V21G possibly damaging Het
Psrc1 C A 3: 108,386,557 S230* probably null Het
Rabep1 C CT 11: 70,940,084 probably null Het
Rai1 A G 11: 60,187,563 N818D probably benign Het
Rap1gap2 C T 11: 74,596,895 E52K probably benign Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rc3h2 G A 2: 37,409,556 A154V possibly damaging Het
Rnf112 A G 11: 61,450,949 L343P unknown Het
Rnf167 C CACAGGGA 11: 70,650,820 probably null Het
Rtn3 G C 19: 7,482,977 P36R unknown Het
Rtn4rl1 C T 11: 75,266,037 P432S probably benign Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc6a4 G A 11: 77,010,556 G39E probably benign Het
Slc6a4 A G 11: 77,013,032 K152R probably benign Het
Smcr8 A G 11: 60,777,980 probably benign Het
Smcr8 T C 11: 60,779,106 V360A probably benign Het
Smcr8 C A 11: 60,779,873 R616S probably benign Het
Smg6 G T 11: 75,156,266 A1262S probably benign Het
Spink12 G A 18: 44,104,708 A18T probably benign Het
Spns3 T C 11: 72,550,037 I58V probably benign Het
Spns3 G A 11: 72,550,091 P40S probably benign Het
Spns3 T C 11: 72,550,160 S17G probably benign Het
Srebf1 C T 11: 60,206,235 V256M probably benign Het
Tekt1 T C 11: 72,359,771 Q33R probably benign Het
Timm22 T G 11: 76,407,117 V18G probably benign Het
Tmem102 C G 11: 69,805,076 G53A possibly damaging Het
Tmem102 G C 11: 69,805,101 R45G probably benign Het
Tmem11 A G 11: 60,875,832 probably benign Het
Tom1l2 C T 11: 60,241,856 A414T probably benign Het
Top3a C T 11: 60,750,584 G425S probably benign Het
Trim16 C T 11: 62,820,602 A33V probably benign Het
Trim16 G C 11: 62,820,676 V58L probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,820,690 probably benign Het
Trim16 A AAGC 11: 62,820,695 probably benign Het
Trim16 G A 11: 62,836,817 E322K probably benign Het
Trim16 T C 11: 62,840,746 V481A probably benign Het
Trim16 C A 11: 62,840,849 D515E probably benign Het
Trim17 G A 11: 58,965,505 M129I probably benign Het
Trim17 A G 11: 58,970,446 N259S probably benign Het
Trim58 C A 11: 58,640,858 L131M possibly damaging Het
Trim58 A G 11: 58,651,660 N482S probably benign Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Trpv1 C G 11: 73,240,601 P322A possibly damaging Het
Trpv1 C A 11: 73,254,291 D734E probably benign Het
Trpv3 C T 11: 73,269,687 A9V probably benign Het
Trpv3 G A 11: 73,278,977 A125T probably benign Het
Trpv3 A G 11: 73,283,676 T290A probably benign Het
Tvp23b A C 11: 62,881,943 N7H possibly damaging Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,855,719 probably benign Het
Usp43 C T 11: 67,856,506 G792S probably benign Het
Utrn C T 10: 12,669,747 R1718H probably damaging Het
Vamp2 C T 11: 69,088,585 probably benign Het
Vamp2 G A 11: 69,090,063 G124R possibly damaging Het
Wdr4 C T 17: 31,512,203 G61E probably damaging Het
Xaf1 G A 11: 72,306,600 R134H probably benign Het
Xaf1 G C 11: 72,306,603 C135S probably damaging Het
Xaf1 C A 11: 72,306,608 L137I probably benign Het
Xaf1 A G 11: 72,308,650 E71G probably benign Het
Xaf1 T G 11: 72,308,966 C176W unknown Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,309,020 probably null Het
Xaf1 GCT GCTGGCCACCT 11: 72,309,021 probably null Het
Xaf1 T TGGCCAGCA 11: 72,309,023 probably null Het
Xaf1 G C 11: 72,309,030 V198L unknown Het
Xaf1 T C 11: 72,309,055 L206S unknown Het
Zfp286 G A 11: 62,784,956 T60M probably damaging Het
Zfp286 A G 11: 62,787,969 V44A probably benign Het
Zfp287 C T 11: 62,713,807 R758H probably benign Het
Zfp287 C G 11: 62,715,349 C244S probably benign Het
Zfp287 G A 11: 62,722,931 R225* probably null Het
Zfp39 G C 11: 58,890,045 Y630* probably null Het
Zfp39 A C 11: 58,890,047 Y630D probably benign Het
Zfp39 G C 11: 58,890,304 T544R possibly damaging Het
Zfp39 G C 11: 58,890,447 D496E probably benign Het
Zfp39 T C 11: 58,890,448 D496G possibly damaging Het
Zfp39 T C 11: 58,890,700 N412S possibly damaging Het
Zfp39 G T 11: 58,890,771 N388K probably benign Het
Zfp39 A G 11: 58,890,779 S386P probably benign Het
Zfp39 A G 11: 58,890,898 V346A probably benign Het
Zfp39 T A 11: 58,890,925 K337M probably benign Het
Zfp39 T A 11: 58,891,141 H265L probably damaging Het
Zfp39 A G 11: 58,891,297 I213T probably benign Het
Zfp39 T C 11: 58,891,316 K207E probably benign Het
Zfp39 G T 11: 58,900,581 S93R probably benign Het
Zfp39 T G 11: 58,900,583 S93R probably benign Het
Zfp672 G T 11: 58,329,626 T49K unknown Het
Zfp692 G T 11: 58,309,033 E149D probably benign Het
Zfp692 G A 11: 58,310,018 V242I probably benign Het
Zfpm1 C A 8: 122,333,873 L234M probably damaging Het
Zzef1 G A 11: 72,889,182 R1927H probably benign Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 splice site probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
R7599:Itgae UTSW 11 73121960 missense possibly damaging 0.62
R7637:Itgae UTSW 11 73113631 missense probably damaging 1.00
R7763:Itgae UTSW 11 73123269 critical splice donor site probably null
R7829:Itgae UTSW 11 73138792 missense probably benign
R7860:Itgae UTSW 11 73120273 critical splice acceptor site probably null
R7978:Itgae UTSW 11 73134087 missense probably damaging 0.98
R8197:Itgae UTSW 11 73120384 missense probably benign
R8911:Itgae UTSW 11 73113621 missense probably damaging 1.00
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Z1186:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1186:Itgae UTSW 11 73115640 missense probably benign
Z1186:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1186:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1186:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1186:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1187:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1187:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1187:Itgae UTSW 11 73115640 missense probably benign
Z1187:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1187:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1187:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1187:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1188:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1188:Itgae UTSW 11 73115640 missense probably benign
Z1188:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1188:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1188:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1188:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1189:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1189:Itgae UTSW 11 73115640 missense probably benign
Z1189:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1189:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1189:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1189:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1190:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1190:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1190:Itgae UTSW 11 73115640 missense probably benign
Z1190:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1190:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1190:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1190:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1191:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1191:Itgae UTSW 11 73115640 missense probably benign
Z1191:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1191:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1191:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1191:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1192:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1192:Itgae UTSW 11 73115640 missense probably benign
Z1192:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1192:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1192:Itgae UTSW 11 73121957 missense probably benign 0.00
Predicted Primers
Posted On2021-03-08