Mutagenetix > Incidental Mutation

Incidental Mutation 'R8765:Atp6v0a2'

667818

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R8765 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124716470 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 630 (M630I)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: M630I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: M630I

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197161

SMART Domains

Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610044O15Rik8	T	C	8: 129,221,589	D49G	probably benign	Het
3632451O06Rik	C	T	14: 49,682,643	R743K	probably damaging	Het
4932414N04Rik	G	A	2: 68,736,612	D452N	possibly damaging	Het
Actr1a	G	T	19: 46,384,348		probably benign	Het
Alox15	A	G	11: 70,349,993	V187A	probably benign	Het
Alpk1	A	T	3: 127,672,469	N1129K	probably damaging	Het
Angptl1	A	G	1: 156,857,157	N299D	probably benign	Het
Ank2	T	C	3: 127,057,082	T128A	possibly damaging	Het
Arsj	G	A	3: 126,439,132	R509K	probably benign	Het
BC107364	T	C	3: 96,434,435	H122R	unknown	Het
Bdh2	T	C	3: 135,291,080	M112T	probably benign	Het
C1qtnf3	G	A	15: 10,952,757		probably null	Het
Cables1	T	C	18: 11,923,365	L326P	probably benign	Het
Cacna1c	C	A	6: 118,603,883	A1769S		Het
Cacna2d2	T	C	9: 107,517,159	L567P	probably damaging	Het
Cacnb4	C	T	2: 52,436,989	R399H	probably damaging	Het
Cacng4	A	C	11: 107,735,150	I205S	probably damaging	Het
Ciz1	A	G	2: 32,370,883	K269E	probably damaging	Het
Csf1	A	G	3: 107,756,675	V35A	probably benign	Het
Csmd1	G	T	8: 16,710,611	Y169*	probably null	Het
Ctnna1	T	A	18: 35,251,240	M756K	probably damaging	Het
Dnah7b	T	A	1: 46,352,999	L3840Q	possibly damaging	Het
Fabp9	T	C	3: 10,193,753	*143W	probably null	Het
Fh1	C	T	1: 175,607,812		probably benign	Het
Fmo2	T	C	1: 162,880,397	T390A	probably benign	Het
Fsip1	G	T	2: 118,251,673	D93E	possibly damaging	Het
Gm10424	T	C	5: 95,271,588	M1V	probably null	Het
Golga5	A	G	12: 102,479,704	D406G	probably benign	Het
Gucy2d	C	A	7: 98,459,140	A760E	probably benign	Het
Hax1	T	C	3: 89,997,473	I141V	probably benign	Het
Hid1	T	A	11: 115,348,960		probably null	Het
Hmcn1	C	T	1: 150,680,662	V2458I	probably damaging	Het
Igkv4-72	A	G	6: 69,226,910	V99A	probably benign	Het
Igkv5-39	G	A	6: 69,900,931	S16L	probably benign	Het
Ints4	T	A	7: 97,501,809	D294E	possibly damaging	Het
Lcn11	A	G	2: 25,778,127	Y99C	probably damaging	Het
Lrrc8b	G	A	5: 105,481,267	R493H	probably benign	Het
Mon1b	A	T	8: 113,636,249	D43V	possibly damaging	Het
Mrpl9	G	A	3: 94,447,822	V234I	possibly damaging	Het
Nek10	A	T	14: 14,999,104	E1034D	probably damaging	Het
Nfxl1	T	C	5: 72,529,100	H586R	probably benign	Het
Nit2	T	A	16: 57,159,469	D211V	probably benign	Het
Nle1	G	A	11: 82,903,056	R385C	probably damaging	Het
Olfr1335	T	C	4: 118,808,962	T301A	probably benign	Het
Olfr1357	C	T	10: 78,612,595	M15I	probably benign	Het
Olfr324	G	T	11: 58,597,959	V182F	possibly damaging	Het
Olfr447	T	C	6: 42,912,168	V215A	probably benign	Het
Olfr522	T	C	7: 140,162,554	H132R	probably benign	Het
Olfr806	A	G	10: 129,738,642	Y92H	probably damaging	Het
Pcdh10	T	C	3: 45,379,488	I79T	probably damaging	Het
Peg10	A	G	6: 4,754,492	D91G	unknown	Het
Plec	C	T	15: 76,181,845	A1342T	unknown	Het
Ppp2r3d	A	G	9: 124,439,649	V68A		Het
Psd3	A	T	8: 67,963,441	D315E	possibly damaging	Het
Rack1	A	G	11: 48,803,459	N162S	probably benign	Het
Slc12a8	C	A	16: 33,518,361	H11Q	possibly damaging	Het
Slc44a5	A	T	3: 154,262,924	D584V	probably damaging	Het
Spata18	T	C	5: 73,668,649	S100P		Het
Stap2	G	T	17: 56,003,145	S53R	probably damaging	Het
Timeless	T	C	10: 128,244,543		probably null	Het
Tlk1	A	T	2: 70,752,237	S183T	probably benign	Het
Tpp2	T	A	1: 43,972,689		probably null	Het
Ttn	A	T	2: 76,824,319		probably benign	Het
Uri1	A	G	7: 37,996,720	V40A	probably benign	Het
Vmn1r15	T	C	6: 57,258,600	V151A	probably benign	Het
Vmn1r198	A	C	13: 22,355,099	I252L	probably damaging	Het
Vmn2r101	T	A	17: 19,588,983	W125R	probably damaging	Het
Wdr89	A	G	12: 75,632,914	S189P	probably damaging	Het
Zfp873	T	A	10: 82,060,238	C268S	probably damaging	Het
Zfp932	T	A	5: 110,006,961	D8E	probably benign	Het
Zfyve16	T	C	13: 92,521,547	R619G	probably benign	Het
Zswim2	A	T	2: 83,941,087	I31N	probably damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCGCCATAACAACAGAGC -3'
(R):5'- ATTCTGAGAACACTGCAAAAGG -3'

Sequencing Primer
(F):5'- ATCAGCCACCTCCCTCACTG -3'
(R):5'- TTCTGAGAACACTGCAAAAGGAGAAG -3'

Posted On

2021-03-08