Incidental Mutation 'R8766:Zfp592'
ID 667885
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms A730014M16Rik
MMRRC Submission 068600-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R8766 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80643432-80694912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80674353 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 439 (H439L)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect probably benign
Transcript: ENSMUST00000107353
AA Change: H439L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: H439L

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 T G 12: 71,001,430 (GRCm39) probably null Het
Amz1 A G 5: 140,733,921 (GRCm39) N166D probably benign Het
Armh4 T A 14: 50,011,497 (GRCm39) N70I probably damaging Het
Asah2 A G 19: 32,035,280 (GRCm39) F15S possibly damaging Het
Axin2 A G 11: 108,814,657 (GRCm39) M182V probably damaging Het
Cacna1s T C 1: 136,002,881 (GRCm39) L326P probably damaging Het
Ccdc169 T C 3: 55,058,245 (GRCm39) probably null Het
Cct8 A T 16: 87,285,756 (GRCm39) V234D probably damaging Het
Cdh19 T C 1: 110,817,844 (GRCm39) R633G probably benign Het
Clca3a1 A T 3: 144,714,939 (GRCm39) probably benign Het
Crat G A 2: 30,297,075 (GRCm39) P293S probably benign Het
Crybg3 G A 16: 59,375,696 (GRCm39) R139C probably benign Het
Ctbs A G 3: 146,165,588 (GRCm39) N301S possibly damaging Het
Cyp4x1 T C 4: 114,967,262 (GRCm39) H438R probably damaging Het
Dglucy C A 12: 100,837,706 (GRCm39) H616Q probably benign Het
Dync1i1 T A 6: 5,767,142 (GRCm39) L74Q possibly damaging Het
Epn1 T C 7: 5,095,860 (GRCm39) S167P possibly damaging Het
Fbxw28 T C 9: 109,155,749 (GRCm39) E341G probably benign Het
Gk2 T A 5: 97,604,110 (GRCm39) M243L probably benign Het
Grhl3 T A 4: 135,300,724 (GRCm39) E4D probably benign Het
Hsd17b13 T C 5: 104,125,009 (GRCm39) K58R probably benign Het
Ighd5-7 G A 12: 113,428,148 (GRCm39) Q9* probably null Het
Izumo1 G A 7: 45,276,496 (GRCm39) S353N probably benign Het
Klhl31 T C 9: 77,557,445 (GRCm39) S54P possibly damaging Het
Lonp2 T C 8: 87,363,198 (GRCm39) M272T probably benign Het
Ltbp1 T A 17: 75,603,250 (GRCm39) C682* probably null Het
Magi2 A G 5: 20,400,123 (GRCm39) K52E probably benign Het
Nab2 C T 10: 127,502,417 (GRCm39) probably benign Het
Ncapg2 T A 12: 116,390,356 (GRCm39) V435D probably damaging Het
Nid2 A G 14: 19,802,340 (GRCm39) D87G probably benign Het
Or10a3 A G 7: 108,480,453 (GRCm39) M120T probably benign Het
Or9a7 T C 6: 40,521,485 (GRCm39) M143V probably benign Het
Pamr1 T C 2: 102,380,538 (GRCm39) M1T probably null Het
Pard3b T C 1: 62,198,637 (GRCm39) C242R probably benign Het
Pcif1 T A 2: 164,727,346 (GRCm39) V106E probably benign Het
Pitx2 T A 3: 129,012,223 (GRCm39) F218I probably damaging Het
Ppip5k1 G T 2: 121,166,919 (GRCm39) Y877* probably null Het
Prkch A G 12: 73,749,312 (GRCm39) N354S probably benign Het
Psen2 T A 1: 180,073,201 (GRCm39) D40V probably benign Het
Rfx7 T A 9: 72,524,021 (GRCm39) S404T possibly damaging Het
Ryr2 T A 13: 11,683,855 (GRCm39) T3070S probably damaging Het
Slc24a4 A G 12: 102,196,711 (GRCm39) D263G probably benign Het
Tox T C 4: 6,823,047 (GRCm39) E90G probably damaging Het
Unc13b C T 4: 43,174,722 (GRCm39) S1850L unknown Het
Vmn1r5 T A 6: 56,963,100 (GRCm39) D258E possibly damaging Het
Vmn2r84 C T 10: 130,222,241 (GRCm39) V660M probably damaging Het
Yju2b C T 8: 84,988,423 (GRCm39) R68H probably damaging Het
Zfp775 A T 6: 48,597,113 (GRCm39) H329L probably damaging Het
Zswim5 T C 4: 116,816,004 (GRCm39) L364P probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 80,691,296 (GRCm39) nonsense probably null
IGL01984:Zfp592 APN 7 80,688,392 (GRCm39) missense probably benign 0.00
IGL02079:Zfp592 APN 7 80,688,978 (GRCm39) missense probably benign 0.20
IGL02096:Zfp592 APN 7 80,674,796 (GRCm39) missense probably damaging 1.00
IGL02125:Zfp592 APN 7 80,687,932 (GRCm39) missense probably benign 0.00
IGL02374:Zfp592 APN 7 80,674,731 (GRCm39) missense probably damaging 1.00
IGL02419:Zfp592 APN 7 80,687,993 (GRCm39) missense probably damaging 1.00
IGL02466:Zfp592 APN 7 80,673,746 (GRCm39) missense probably damaging 1.00
IGL02485:Zfp592 APN 7 80,687,718 (GRCm39) splice site probably benign
IGL02500:Zfp592 APN 7 80,691,474 (GRCm39) missense probably benign
IGL02876:Zfp592 APN 7 80,687,875 (GRCm39) missense probably benign 0.01
IGL02940:Zfp592 APN 7 80,674,575 (GRCm39) missense probably damaging 1.00
R0326:Zfp592 UTSW 7 80,674,637 (GRCm39) missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 80,687,819 (GRCm39) missense probably damaging 1.00
R0684:Zfp592 UTSW 7 80,687,623 (GRCm39) missense probably benign 0.00
R0750:Zfp592 UTSW 7 80,674,493 (GRCm39) missense probably benign
R1346:Zfp592 UTSW 7 80,687,812 (GRCm39) missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 80,674,227 (GRCm39) missense probably damaging 0.99
R1650:Zfp592 UTSW 7 80,687,848 (GRCm39) missense probably benign 0.04
R1804:Zfp592 UTSW 7 80,673,443 (GRCm39) missense probably damaging 1.00
R1918:Zfp592 UTSW 7 80,687,168 (GRCm39) nonsense probably null
R2114:Zfp592 UTSW 7 80,674,544 (GRCm39) missense probably damaging 1.00
R2144:Zfp592 UTSW 7 80,687,950 (GRCm39) missense probably benign 0.01
R2164:Zfp592 UTSW 7 80,691,186 (GRCm39) missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 80,691,361 (GRCm39) missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 80,687,159 (GRCm39) nonsense probably null
R3809:Zfp592 UTSW 7 80,674,280 (GRCm39) missense probably benign 0.00
R4574:Zfp592 UTSW 7 80,673,534 (GRCm39) missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 80,691,607 (GRCm39) missense probably damaging 1.00
R5023:Zfp592 UTSW 7 80,674,095 (GRCm39) missense probably damaging 1.00
R5121:Zfp592 UTSW 7 80,673,309 (GRCm39) missense probably damaging 1.00
R5174:Zfp592 UTSW 7 80,688,073 (GRCm39) missense probably damaging 1.00
R5794:Zfp592 UTSW 7 80,674,781 (GRCm39) missense probably benign 0.00
R5946:Zfp592 UTSW 7 80,687,645 (GRCm39) missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 80,673,184 (GRCm39) missense probably benign 0.05
R6657:Zfp592 UTSW 7 80,675,234 (GRCm39) missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R6872:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R7056:Zfp592 UTSW 7 80,673,067 (GRCm39) missense probably damaging 1.00
R7295:Zfp592 UTSW 7 80,674,070 (GRCm39) missense probably damaging 1.00
R7351:Zfp592 UTSW 7 80,691,439 (GRCm39) missense probably benign 0.00
R7475:Zfp592 UTSW 7 80,673,200 (GRCm39) missense probably damaging 0.99
R7509:Zfp592 UTSW 7 80,688,088 (GRCm39) missense probably damaging 0.99
R7552:Zfp592 UTSW 7 80,673,390 (GRCm39) missense probably benign 0.01
R7737:Zfp592 UTSW 7 80,674,941 (GRCm39) missense probably damaging 1.00
R7752:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R7901:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R8100:Zfp592 UTSW 7 80,673,940 (GRCm39) missense probably benign 0.05
R8440:Zfp592 UTSW 7 80,691,271 (GRCm39) missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 80,673,321 (GRCm39) missense probably damaging 1.00
R9083:Zfp592 UTSW 7 80,674,644 (GRCm39) missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9194:Zfp592 UTSW 7 80,674,349 (GRCm39) missense probably benign
R9197:Zfp592 UTSW 7 80,674,067 (GRCm39) missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 80,691,529 (GRCm39) missense probably benign 0.03
R9321:Zfp592 UTSW 7 80,691,226 (GRCm39) missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9785:Zfp592 UTSW 7 80,673,245 (GRCm39) missense probably damaging 1.00
X0022:Zfp592 UTSW 7 80,687,935 (GRCm39) nonsense probably null
X0028:Zfp592 UTSW 7 80,673,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAACAATTAAGACATCATCGGGG -3'
(R):5'- TTCAAGTTGGCCAAGTGCAC -3'

Sequencing Primer
(F):5'- TTAAGACATCATCGGGGGAAATC -3'
(R):5'- TGGCCAAGTGCACAGCTTTG -3'
Posted On 2021-03-08