Mutagenetix > Incidental Mutation

Incidental Mutation 'R8766:Prkch'

667895

Institutional Source

Beutler Lab

Gene Symbol

Prkch

Ensembl Gene

ENSMUSG00000021108

Gene Name

protein kinase C, eta

Synonyms

Pkch

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8766 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73584796-73778185 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73702538 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 354 (N354S)

Ref Sequence

ENSEMBL: ENSMUSP00000021527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]

AlphaFold

P23298

Predicted Effect

probably benign
Transcript: ENSMUST00000021527
AA Change: N354S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: N354S

Domain	Start	End	E-Value	Type
C2	11	117	1.28e-13	SMART
C1	172	222	7.92e-14	SMART
C1	246	295	2.48e-15	SMART
S_TKc	355	614	5.62e-100	SMART
S_TK_X	615	678	8.32e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221153

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,774,040	N70I	probably damaging	Het
Actr10	T	G	12: 70,954,656		probably null	Het
Amz1	A	G	5: 140,748,166	N166D	probably benign	Het
Asah2	A	G	19: 32,057,880	F15S	possibly damaging	Het
Axin2	A	G	11: 108,923,831	M182V	probably damaging	Het
Cacna1s	T	C	1: 136,075,143	L326P	probably damaging	Het
Ccdc130	C	T	8: 84,261,794	R68H	probably damaging	Het
Ccdc169	T	C	3: 55,150,824		probably null	Het
Cct8	A	T	16: 87,488,868	V234D	probably damaging	Het
Cdh19	T	C	1: 110,890,114	R633G	probably benign	Het
Clca1	A	T	3: 145,009,178		probably benign	Het
Crat	G	A	2: 30,407,063	P293S	probably benign	Het
Crybg3	G	A	16: 59,555,333	R139C	probably benign	Het
Ctbs	A	G	3: 146,459,833	N301S	possibly damaging	Het
Cyp4x1	T	C	4: 115,110,065	H438R	probably damaging	Het
Dglucy	C	A	12: 100,871,447	H616Q	probably benign	Het
Dync1i1	T	A	6: 5,767,142	L74Q	possibly damaging	Het
Epn1	T	C	7: 5,092,861	S167P	possibly damaging	Het
Fbxw28	T	C	9: 109,326,681	E341G	probably benign	Het
Gk2	T	A	5: 97,456,251	M243L	probably benign	Het
Grhl3	T	A	4: 135,573,413	E4D	probably benign	Het
Hsd17b13	T	C	5: 103,977,143	K58R	probably benign	Het
Ighd5-7	G	A	12: 113,464,528	Q9*	probably null	Het
Izumo1	G	A	7: 45,627,072	S353N	probably benign	Het
Klhl31	T	C	9: 77,650,163	S54P	possibly damaging	Het
Lonp2	T	C	8: 86,636,570	M272T	probably benign	Het
Ltbp1	T	A	17: 75,296,255	C682*	probably null	Het
Magi2	A	G	5: 20,195,125	K52E	probably benign	Het
Nab2	C	T	10: 127,666,548		probably benign	Het
Ncapg2	T	A	12: 116,426,736	V435D	probably damaging	Het
Nid2	A	G	14: 19,752,272	D87G	probably benign	Het
Olfr461	T	C	6: 40,544,551	M143V	probably benign	Het
Olfr518	A	G	7: 108,881,246	M120T	probably benign	Het
Pamr1	T	C	2: 102,550,193	M1T	probably null	Het
Pard3b	T	C	1: 62,159,478	C242R	probably benign	Het
Pcif1	T	A	2: 164,885,426	V106E	probably benign	Het
Pitx2	T	A	3: 129,218,574	F218I	probably damaging	Het
Ppip5k1	G	T	2: 121,336,438	Y877*	probably null	Het
Psen2	T	A	1: 180,245,636	D40V	probably benign	Het
Rfx7	T	A	9: 72,616,739	S404T	possibly damaging	Het
Ryr2	T	A	13: 11,668,969	T3070S	probably damaging	Het
Slc24a4	A	G	12: 102,230,452	D263G	probably benign	Het
Tox	T	C	4: 6,823,047	E90G	probably damaging	Het
Unc13b	C	T	4: 43,174,722	S1850L	unknown	Het
Vmn1r5	T	A	6: 56,986,115	D258E	possibly damaging	Het
Vmn2r84	C	T	10: 130,386,372	V660M	probably damaging	Het
Zfp592	A	T	7: 81,024,605	H439L	probably benign	Het
Zfp775	A	T	6: 48,620,179	H329L	probably damaging	Het
Zswim5	T	C	4: 116,958,807	L364P	probably damaging	Het

Other mutations in Prkch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Prkch	APN	12	73702589	splice site	probably benign
IGL00548:Prkch	APN	12	73702811	missense	probably damaging	1.00
IGL01310:Prkch	APN	12	73759013	missense	possibly damaging	0.78
IGL01782:Prkch	APN	12	73759662	missense	probably damaging	1.00
IGL02335:Prkch	APN	12	73702512	missense	probably benign	0.00
Nighthawk	UTSW	12	73721842	missense	probably damaging	1.00
Topsoil	UTSW	12	73585527	critical splice donor site	probably null
wolfcreek	UTSW	12	73759710	missense	probably damaging	1.00
G1Funyon:Prkch	UTSW	12	73702764	missense	possibly damaging	0.71
R0084:Prkch	UTSW	12	73697987	missense	possibly damaging	0.87
R0127:Prkch	UTSW	12	73721787	missense	possibly damaging	0.94
R0471:Prkch	UTSW	12	73691652	missense	probably benign	0.03
R0490:Prkch	UTSW	12	73759676	missense	probably damaging	1.00
R1402:Prkch	UTSW	12	73585389	missense	probably damaging	1.00
R1402:Prkch	UTSW	12	73585389	missense	probably damaging	1.00
R1552:Prkch	UTSW	12	73702546	missense	probably benign	0.33
R1572:Prkch	UTSW	12	73649357	critical splice donor site	probably null
R1651:Prkch	UTSW	12	73759001	missense	possibly damaging	0.88
R2114:Prkch	UTSW	12	73702516	missense	probably benign
R3714:Prkch	UTSW	12	73775516	missense	probably damaging	1.00
R4515:Prkch	UTSW	12	73702838	missense	possibly damaging	0.76
R4749:Prkch	UTSW	12	73692960	missense	probably damaging	1.00
R4977:Prkch	UTSW	12	73702893	missense	possibly damaging	0.52
R5381:Prkch	UTSW	12	73691592	missense	probably damaging	0.99
R5682:Prkch	UTSW	12	73697950	missense	probably damaging	1.00
R6526:Prkch	UTSW	12	73702775	missense	probably damaging	1.00
R6864:Prkch	UTSW	12	73759617	missense	probably damaging	1.00
R7484:Prkch	UTSW	12	73585527	critical splice donor site	probably null
R8074:Prkch	UTSW	12	73700267	missense	possibly damaging	0.49
R8294:Prkch	UTSW	12	73759710	missense	probably damaging	1.00
R8301:Prkch	UTSW	12	73702764	missense	possibly damaging	0.71
R8312:Prkch	UTSW	12	73760584	missense	noncoding transcript
R8734:Prkch	UTSW	12	73585244	missense	possibly damaging	0.62
R8998:Prkch	UTSW	12	73696199	missense	probably damaging	1.00
R8999:Prkch	UTSW	12	73696199	missense	probably damaging	1.00
R9058:Prkch	UTSW	12	73775534	critical splice donor site	probably null
R9152:Prkch	UTSW	12	73691644	missense	possibly damaging	0.91
R9176:Prkch	UTSW	12	73700194	missense	probably damaging	1.00
R9194:Prkch	UTSW	12	73721842	missense	probably damaging	1.00
R9691:Prkch	UTSW	12	73758956	missense	probably damaging	1.00
R9764:Prkch	UTSW	12	73700304	missense	probably benign	0.00
R9794:Prkch	UTSW	12	73697970	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- AGACAGGCTGCTTGCATAG -3'
(R):5'- CTGGCAAGCATCACCTAGAG -3'

Sequencing Primer
(F):5'- CTGCTTGCATAGGGAGGTCTC -3'
(R):5'- GCATCACCTAGAGCAAAGCAGG -3'

Posted On

2021-03-08