Incidental Mutation 'R8766:Prkch'
ID 667895
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Name protein kinase C, eta
Synonyms Pkch
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8766 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 73584796-73778185 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73702538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 354 (N354S)
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
AlphaFold P23298
Predicted Effect probably benign
Transcript: ENSMUST00000021527
AA Change: N354S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: N354S

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221153
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,774,040 N70I probably damaging Het
Actr10 T G 12: 70,954,656 probably null Het
Amz1 A G 5: 140,748,166 N166D probably benign Het
Asah2 A G 19: 32,057,880 F15S possibly damaging Het
Axin2 A G 11: 108,923,831 M182V probably damaging Het
Cacna1s T C 1: 136,075,143 L326P probably damaging Het
Ccdc130 C T 8: 84,261,794 R68H probably damaging Het
Ccdc169 T C 3: 55,150,824 probably null Het
Cct8 A T 16: 87,488,868 V234D probably damaging Het
Cdh19 T C 1: 110,890,114 R633G probably benign Het
Clca1 A T 3: 145,009,178 probably benign Het
Crat G A 2: 30,407,063 P293S probably benign Het
Crybg3 G A 16: 59,555,333 R139C probably benign Het
Ctbs A G 3: 146,459,833 N301S possibly damaging Het
Cyp4x1 T C 4: 115,110,065 H438R probably damaging Het
Dglucy C A 12: 100,871,447 H616Q probably benign Het
Dync1i1 T A 6: 5,767,142 L74Q possibly damaging Het
Epn1 T C 7: 5,092,861 S167P possibly damaging Het
Fbxw28 T C 9: 109,326,681 E341G probably benign Het
Gk2 T A 5: 97,456,251 M243L probably benign Het
Grhl3 T A 4: 135,573,413 E4D probably benign Het
Hsd17b13 T C 5: 103,977,143 K58R probably benign Het
Ighd5-7 G A 12: 113,464,528 Q9* probably null Het
Izumo1 G A 7: 45,627,072 S353N probably benign Het
Klhl31 T C 9: 77,650,163 S54P possibly damaging Het
Lonp2 T C 8: 86,636,570 M272T probably benign Het
Ltbp1 T A 17: 75,296,255 C682* probably null Het
Magi2 A G 5: 20,195,125 K52E probably benign Het
Nab2 C T 10: 127,666,548 probably benign Het
Ncapg2 T A 12: 116,426,736 V435D probably damaging Het
Nid2 A G 14: 19,752,272 D87G probably benign Het
Olfr461 T C 6: 40,544,551 M143V probably benign Het
Olfr518 A G 7: 108,881,246 M120T probably benign Het
Pamr1 T C 2: 102,550,193 M1T probably null Het
Pard3b T C 1: 62,159,478 C242R probably benign Het
Pcif1 T A 2: 164,885,426 V106E probably benign Het
Pitx2 T A 3: 129,218,574 F218I probably damaging Het
Ppip5k1 G T 2: 121,336,438 Y877* probably null Het
Psen2 T A 1: 180,245,636 D40V probably benign Het
Rfx7 T A 9: 72,616,739 S404T possibly damaging Het
Ryr2 T A 13: 11,668,969 T3070S probably damaging Het
Slc24a4 A G 12: 102,230,452 D263G probably benign Het
Tox T C 4: 6,823,047 E90G probably damaging Het
Unc13b C T 4: 43,174,722 S1850L unknown Het
Vmn1r5 T A 6: 56,986,115 D258E possibly damaging Het
Vmn2r84 C T 10: 130,386,372 V660M probably damaging Het
Zfp592 A T 7: 81,024,605 H439L probably benign Het
Zfp775 A T 6: 48,620,179 H329L probably damaging Het
Zswim5 T C 4: 116,958,807 L364P probably damaging Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
wolfcreek UTSW 12 73759710 missense probably damaging 1.00
G1Funyon:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
R8734:Prkch UTSW 12 73585244 missense possibly damaging 0.62
R8998:Prkch UTSW 12 73696199 missense probably damaging 1.00
R8999:Prkch UTSW 12 73696199 missense probably damaging 1.00
R9058:Prkch UTSW 12 73775534 critical splice donor site probably null
R9152:Prkch UTSW 12 73691644 missense possibly damaging 0.91
R9176:Prkch UTSW 12 73700194 missense probably damaging 1.00
R9194:Prkch UTSW 12 73721842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGGCTGCTTGCATAG -3'
(R):5'- CTGGCAAGCATCACCTAGAG -3'

Sequencing Primer
(F):5'- CTGCTTGCATAGGGAGGTCTC -3'
(R):5'- GCATCACCTAGAGCAAAGCAGG -3'
Posted On 2021-03-08