Incidental Mutation 'R8766:Asah2'
ID 667906
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene Name N-acylsphingosine amidohydrolase 2
Synonyms neutral/alkaline ceramidase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R8766 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 31984654-32061469 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32057880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 15 (F15S)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
AlphaFold Q9JHE3
Predicted Effect possibly damaging
Transcript: ENSMUST00000096119
AA Change: F15S

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: F15S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,774,040 N70I probably damaging Het
Actr10 T G 12: 70,954,656 probably null Het
Amz1 A G 5: 140,748,166 N166D probably benign Het
Axin2 A G 11: 108,923,831 M182V probably damaging Het
Cacna1s T C 1: 136,075,143 L326P probably damaging Het
Ccdc130 C T 8: 84,261,794 R68H probably damaging Het
Ccdc169 T C 3: 55,150,824 probably null Het
Cct8 A T 16: 87,488,868 V234D probably damaging Het
Cdh19 T C 1: 110,890,114 R633G probably benign Het
Clca1 A T 3: 145,009,178 probably benign Het
Crat G A 2: 30,407,063 P293S probably benign Het
Crybg3 G A 16: 59,555,333 R139C probably benign Het
Ctbs A G 3: 146,459,833 N301S possibly damaging Het
Cyp4x1 T C 4: 115,110,065 H438R probably damaging Het
Dglucy C A 12: 100,871,447 H616Q probably benign Het
Dync1i1 T A 6: 5,767,142 L74Q possibly damaging Het
Epn1 T C 7: 5,092,861 S167P possibly damaging Het
Fbxw28 T C 9: 109,326,681 E341G probably benign Het
Gk2 T A 5: 97,456,251 M243L probably benign Het
Grhl3 T A 4: 135,573,413 E4D probably benign Het
Hsd17b13 T C 5: 103,977,143 K58R probably benign Het
Ighd5-7 G A 12: 113,464,528 Q9* probably null Het
Izumo1 G A 7: 45,627,072 S353N probably benign Het
Klhl31 T C 9: 77,650,163 S54P possibly damaging Het
Lonp2 T C 8: 86,636,570 M272T probably benign Het
Ltbp1 T A 17: 75,296,255 C682* probably null Het
Magi2 A G 5: 20,195,125 K52E probably benign Het
Nab2 C T 10: 127,666,548 probably benign Het
Ncapg2 T A 12: 116,426,736 V435D probably damaging Het
Nid2 A G 14: 19,752,272 D87G probably benign Het
Olfr461 T C 6: 40,544,551 M143V probably benign Het
Olfr518 A G 7: 108,881,246 M120T probably benign Het
Pamr1 T C 2: 102,550,193 M1T probably null Het
Pard3b T C 1: 62,159,478 C242R probably benign Het
Pcif1 T A 2: 164,885,426 V106E probably benign Het
Pitx2 T A 3: 129,218,574 F218I probably damaging Het
Ppip5k1 G T 2: 121,336,438 Y877* probably null Het
Prkch A G 12: 73,702,538 N354S probably benign Het
Psen2 T A 1: 180,245,636 D40V probably benign Het
Rfx7 T A 9: 72,616,739 S404T possibly damaging Het
Ryr2 T A 13: 11,668,969 T3070S probably damaging Het
Slc24a4 A G 12: 102,230,452 D263G probably benign Het
Tox T C 4: 6,823,047 E90G probably damaging Het
Unc13b C T 4: 43,174,722 S1850L unknown Het
Vmn1r5 T A 6: 56,986,115 D258E possibly damaging Het
Vmn2r84 C T 10: 130,386,372 V660M probably damaging Het
Zfp592 A T 7: 81,024,605 H439L probably benign Het
Zfp775 A T 6: 48,620,179 H329L probably damaging Het
Zswim5 T C 4: 116,958,807 L364P probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 32008681 splice site probably benign
IGL02001:Asah2 APN 19 32043539 nonsense probably null
IGL02228:Asah2 APN 19 32016714 missense probably benign 0.09
IGL02377:Asah2 APN 19 32009414 missense probably benign 0.30
IGL03070:Asah2 APN 19 32006344 missense probably damaging 1.00
IGL03233:Asah2 APN 19 32054631 missense probably benign 0.18
IGL03244:Asah2 APN 19 31986942 missense probably damaging 1.00
R0008:Asah2 UTSW 19 32003731 nonsense probably null
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0302:Asah2 UTSW 19 32052956 missense probably benign 0.01
R0497:Asah2 UTSW 19 32054631 missense probably benign 0.18
R0614:Asah2 UTSW 19 32016728 missense probably damaging 1.00
R0639:Asah2 UTSW 19 32008639 missense probably damaging 0.99
R0715:Asah2 UTSW 19 32016776 missense probably damaging 0.97
R1332:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R1336:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R2045:Asah2 UTSW 19 32052956 missense probably benign 0.01
R2062:Asah2 UTSW 19 32024874 missense probably damaging 0.99
R4083:Asah2 UTSW 19 31986784 missense probably benign 0.01
R4698:Asah2 UTSW 19 32054471 splice site probably null
R4731:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4732:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4733:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4773:Asah2 UTSW 19 32052858 missense probably damaging 1.00
R4930:Asah2 UTSW 19 32052906 missense probably benign 0.35
R5081:Asah2 UTSW 19 32014308 missense probably benign 0.07
R5741:Asah2 UTSW 19 32008615 missense probably damaging 1.00
R5873:Asah2 UTSW 19 32003682 critical splice donor site probably null
R5905:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6027:Asah2 UTSW 19 32044951 missense probably benign 0.01
R6028:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6187:Asah2 UTSW 19 32024867 missense probably damaging 0.99
R6667:Asah2 UTSW 19 31995358 missense probably benign 0.41
R6968:Asah2 UTSW 19 32012513 missense probably benign
R7010:Asah2 UTSW 19 32054554 missense probably benign 0.00
R7404:Asah2 UTSW 19 32057854 missense probably benign 0.13
R7575:Asah2 UTSW 19 32016703 missense probably benign 0.11
R7797:Asah2 UTSW 19 32022361 missense probably damaging 1.00
R8492:Asah2 UTSW 19 32006259 missense probably benign 0.25
R8682:Asah2 UTSW 19 32052877 missense probably damaging 1.00
R8873:Asah2 UTSW 19 32044888 critical splice donor site probably null
R8974:Asah2 UTSW 19 32052905 missense probably benign
R9088:Asah2 UTSW 19 32052960 missense probably damaging 1.00
R9405:Asah2 UTSW 19 32008645 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GACACCATTGCTCATCTTGGTG -3'
(R):5'- AGAAGCAGTATGGTGTAGCC -3'

Sequencing Primer
(F):5'- TGGTGCAGTCCAACAATCTAG -3'
(R):5'- CTTGAAGTGCATGCCTGT -3'
Posted On 2021-03-08