Incidental Mutation 'R8766:Asah2'
ID 667906
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene Name N-acylsphingosine amidohydrolase 2
Synonyms neutral/alkaline ceramidase
MMRRC Submission 068600-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.448) question?
Stock # R8766 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 31962046-32080540 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32035280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 15 (F15S)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
AlphaFold Q9JHE3
Predicted Effect possibly damaging
Transcript: ENSMUST00000096119
AA Change: F15S

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: F15S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 T G 12: 71,001,430 (GRCm39) probably null Het
Amz1 A G 5: 140,733,921 (GRCm39) N166D probably benign Het
Armh4 T A 14: 50,011,497 (GRCm39) N70I probably damaging Het
Axin2 A G 11: 108,814,657 (GRCm39) M182V probably damaging Het
Cacna1s T C 1: 136,002,881 (GRCm39) L326P probably damaging Het
Ccdc169 T C 3: 55,058,245 (GRCm39) probably null Het
Cct8 A T 16: 87,285,756 (GRCm39) V234D probably damaging Het
Cdh19 T C 1: 110,817,844 (GRCm39) R633G probably benign Het
Clca3a1 A T 3: 144,714,939 (GRCm39) probably benign Het
Crat G A 2: 30,297,075 (GRCm39) P293S probably benign Het
Crybg3 G A 16: 59,375,696 (GRCm39) R139C probably benign Het
Ctbs A G 3: 146,165,588 (GRCm39) N301S possibly damaging Het
Cyp4x1 T C 4: 114,967,262 (GRCm39) H438R probably damaging Het
Dglucy C A 12: 100,837,706 (GRCm39) H616Q probably benign Het
Dync1i1 T A 6: 5,767,142 (GRCm39) L74Q possibly damaging Het
Epn1 T C 7: 5,095,860 (GRCm39) S167P possibly damaging Het
Fbxw28 T C 9: 109,155,749 (GRCm39) E341G probably benign Het
Gk2 T A 5: 97,604,110 (GRCm39) M243L probably benign Het
Grhl3 T A 4: 135,300,724 (GRCm39) E4D probably benign Het
Hsd17b13 T C 5: 104,125,009 (GRCm39) K58R probably benign Het
Ighd5-7 G A 12: 113,428,148 (GRCm39) Q9* probably null Het
Izumo1 G A 7: 45,276,496 (GRCm39) S353N probably benign Het
Klhl31 T C 9: 77,557,445 (GRCm39) S54P possibly damaging Het
Lonp2 T C 8: 87,363,198 (GRCm39) M272T probably benign Het
Ltbp1 T A 17: 75,603,250 (GRCm39) C682* probably null Het
Magi2 A G 5: 20,400,123 (GRCm39) K52E probably benign Het
Nab2 C T 10: 127,502,417 (GRCm39) probably benign Het
Ncapg2 T A 12: 116,390,356 (GRCm39) V435D probably damaging Het
Nid2 A G 14: 19,802,340 (GRCm39) D87G probably benign Het
Or10a3 A G 7: 108,480,453 (GRCm39) M120T probably benign Het
Or9a7 T C 6: 40,521,485 (GRCm39) M143V probably benign Het
Pamr1 T C 2: 102,380,538 (GRCm39) M1T probably null Het
Pard3b T C 1: 62,198,637 (GRCm39) C242R probably benign Het
Pcif1 T A 2: 164,727,346 (GRCm39) V106E probably benign Het
Pitx2 T A 3: 129,012,223 (GRCm39) F218I probably damaging Het
Ppip5k1 G T 2: 121,166,919 (GRCm39) Y877* probably null Het
Prkch A G 12: 73,749,312 (GRCm39) N354S probably benign Het
Psen2 T A 1: 180,073,201 (GRCm39) D40V probably benign Het
Rfx7 T A 9: 72,524,021 (GRCm39) S404T possibly damaging Het
Ryr2 T A 13: 11,683,855 (GRCm39) T3070S probably damaging Het
Slc24a4 A G 12: 102,196,711 (GRCm39) D263G probably benign Het
Tox T C 4: 6,823,047 (GRCm39) E90G probably damaging Het
Unc13b C T 4: 43,174,722 (GRCm39) S1850L unknown Het
Vmn1r5 T A 6: 56,963,100 (GRCm39) D258E possibly damaging Het
Vmn2r84 C T 10: 130,222,241 (GRCm39) V660M probably damaging Het
Yju2b C T 8: 84,988,423 (GRCm39) R68H probably damaging Het
Zfp592 A T 7: 80,674,353 (GRCm39) H439L probably benign Het
Zfp775 A T 6: 48,597,113 (GRCm39) H329L probably damaging Het
Zswim5 T C 4: 116,816,004 (GRCm39) L364P probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 31,986,081 (GRCm39) splice site probably benign
IGL02001:Asah2 APN 19 32,020,939 (GRCm39) nonsense probably null
IGL02228:Asah2 APN 19 31,994,114 (GRCm39) missense probably benign 0.09
IGL02377:Asah2 APN 19 31,986,814 (GRCm39) missense probably benign 0.30
IGL03070:Asah2 APN 19 31,983,744 (GRCm39) missense probably damaging 1.00
IGL03233:Asah2 APN 19 32,032,031 (GRCm39) missense probably benign 0.18
IGL03244:Asah2 APN 19 31,964,342 (GRCm39) missense probably damaging 1.00
R0008:Asah2 UTSW 19 31,981,131 (GRCm39) nonsense probably null
R0103:Asah2 UTSW 19 31,996,377 (GRCm39) missense probably benign 0.01
R0103:Asah2 UTSW 19 31,996,377 (GRCm39) missense probably benign 0.01
R0302:Asah2 UTSW 19 32,030,356 (GRCm39) missense probably benign 0.01
R0497:Asah2 UTSW 19 32,032,031 (GRCm39) missense probably benign 0.18
R0614:Asah2 UTSW 19 31,994,128 (GRCm39) missense probably damaging 1.00
R0639:Asah2 UTSW 19 31,986,039 (GRCm39) missense probably damaging 0.99
R0715:Asah2 UTSW 19 31,994,176 (GRCm39) missense probably damaging 0.97
R1332:Asah2 UTSW 19 32,022,341 (GRCm39) missense probably damaging 1.00
R1336:Asah2 UTSW 19 32,022,341 (GRCm39) missense probably damaging 1.00
R2045:Asah2 UTSW 19 32,030,356 (GRCm39) missense probably benign 0.01
R2062:Asah2 UTSW 19 32,002,274 (GRCm39) missense probably damaging 0.99
R4083:Asah2 UTSW 19 31,964,184 (GRCm39) missense probably benign 0.01
R4698:Asah2 UTSW 19 32,031,871 (GRCm39) splice site probably null
R4731:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4732:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4733:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4773:Asah2 UTSW 19 32,030,258 (GRCm39) missense probably damaging 1.00
R4930:Asah2 UTSW 19 32,030,306 (GRCm39) missense probably benign 0.35
R5081:Asah2 UTSW 19 31,991,708 (GRCm39) missense probably benign 0.07
R5741:Asah2 UTSW 19 31,986,015 (GRCm39) missense probably damaging 1.00
R5873:Asah2 UTSW 19 31,981,082 (GRCm39) critical splice donor site probably null
R5905:Asah2 UTSW 19 31,993,914 (GRCm39) missense probably damaging 1.00
R6027:Asah2 UTSW 19 32,022,351 (GRCm39) missense probably benign 0.01
R6028:Asah2 UTSW 19 31,993,914 (GRCm39) missense probably damaging 1.00
R6187:Asah2 UTSW 19 32,002,267 (GRCm39) missense probably damaging 0.99
R6667:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R6968:Asah2 UTSW 19 31,989,913 (GRCm39) missense probably benign
R7010:Asah2 UTSW 19 32,031,954 (GRCm39) missense probably benign 0.00
R7404:Asah2 UTSW 19 32,035,254 (GRCm39) missense probably benign 0.13
R7575:Asah2 UTSW 19 31,994,103 (GRCm39) missense probably benign 0.11
R7797:Asah2 UTSW 19 31,999,761 (GRCm39) missense probably damaging 1.00
R8492:Asah2 UTSW 19 31,983,659 (GRCm39) missense probably benign 0.25
R8682:Asah2 UTSW 19 32,030,277 (GRCm39) missense probably damaging 1.00
R8873:Asah2 UTSW 19 32,022,288 (GRCm39) critical splice donor site probably null
R8974:Asah2 UTSW 19 32,030,305 (GRCm39) missense probably benign
R9088:Asah2 UTSW 19 32,030,360 (GRCm39) missense probably damaging 1.00
R9405:Asah2 UTSW 19 31,986,045 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GACACCATTGCTCATCTTGGTG -3'
(R):5'- AGAAGCAGTATGGTGTAGCC -3'

Sequencing Primer
(F):5'- TGGTGCAGTCCAACAATCTAG -3'
(R):5'- CTTGAAGTGCATGCCTGT -3'
Posted On 2021-03-08