Incidental Mutation 'R8767:Fastkd2'
ID 667907
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 068601-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8767 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63769758-63792544 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63775080 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: D342G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: D342G

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,969,224 (GRCm39) T954A probably damaging Het
Arhgap24 A T 5: 103,039,740 (GRCm39) M319L probably benign Het
Aste1 A G 9: 105,274,098 (GRCm39) N113D possibly damaging Het
Ccnh C T 13: 85,356,959 (GRCm39) Q275* probably null Het
Cfi G A 3: 129,644,497 (GRCm39) probably null Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Crybg3 T A 16: 59,376,500 (GRCm39) M1585L probably benign Het
D630036H23Rik A G 12: 36,431,441 (GRCm39) S186P unknown Het
Dnhd1 T C 7: 105,301,330 (GRCm39) L229P probably damaging Het
Dtymk A T 1: 93,728,635 (GRCm39) probably benign Het
Eif4g3 T A 4: 137,930,779 (GRCm39) I1511K probably damaging Het
Entrep3 T G 3: 89,091,725 (GRCm39) probably benign Het
Hcar1 A G 5: 124,017,113 (GRCm39) F193L probably damaging Het
Hivep2 T G 10: 14,004,992 (GRCm39) L530R probably damaging Het
Ilrun T C 17: 27,987,043 (GRCm39) T228A probably benign Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lats2 G A 14: 57,931,781 (GRCm39) T879M probably damaging Het
Lin54 G A 5: 100,600,884 (GRCm39) T503I probably benign Het
Mmp16 T G 4: 18,051,714 (GRCm39) probably benign Het
Muc6 A G 7: 141,229,549 (GRCm39) Y1186H probably damaging Het
Nr3c1 A G 18: 39,619,387 (GRCm39) F300S probably damaging Het
Or2y1g A G 11: 49,171,227 (GRCm39) N84S possibly damaging Het
Or7g21 A C 9: 19,032,922 (GRCm39) I221L possibly damaging Het
Pcdha4 T C 18: 37,086,905 (GRCm39) S363P possibly damaging Het
Ptdss1 C T 13: 67,101,608 (GRCm39) A99V probably benign Het
Ptprz1 T A 6: 22,986,187 (GRCm39) L329Q probably damaging Het
Rnf115 T C 3: 96,695,907 (GRCm39) V231A probably damaging Het
Sh3pxd2a A G 19: 47,257,345 (GRCm39) Y486H probably damaging Het
Shh T A 5: 28,671,487 (GRCm39) N92I possibly damaging Het
Slc13a4 T A 6: 35,245,783 (GRCm39) I621F probably benign Het
Srrm1 T C 4: 135,059,532 (GRCm39) T438A unknown Het
Synj1 A C 16: 90,758,406 (GRCm39) F813V probably damaging Het
Tnrc6a A G 7: 122,783,133 (GRCm39) probably benign Het
Trir T A 8: 85,753,690 (GRCm39) F55I probably damaging Het
Tsr1 A G 11: 74,799,149 (GRCm39) T777A probably damaging Het
Vmn2r5 G A 3: 64,415,103 (GRCm39) R86C possibly damaging Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63,776,930 (GRCm39) splice site probably benign
IGL01890:Fastkd2 APN 1 63,771,320 (GRCm39) missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63,787,158 (GRCm39) missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63,777,083 (GRCm39) splice site probably benign
IGL03208:Fastkd2 APN 1 63,778,365 (GRCm39) missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63,771,187 (GRCm39) missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63,791,559 (GRCm39) missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63,776,970 (GRCm39) missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63,791,499 (GRCm39) missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63,787,114 (GRCm39) splice site probably benign
R1468:Fastkd2 UTSW 1 63,771,385 (GRCm39) unclassified probably benign
R1579:Fastkd2 UTSW 1 63,785,046 (GRCm39) missense probably null 0.00
R1729:Fastkd2 UTSW 1 63,790,459 (GRCm39) nonsense probably null
R3937:Fastkd2 UTSW 1 63,776,995 (GRCm39) missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63,774,968 (GRCm39) intron probably benign
R4473:Fastkd2 UTSW 1 63,770,833 (GRCm39) missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63,785,045 (GRCm39) missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63,789,055 (GRCm39) intron probably benign
R5176:Fastkd2 UTSW 1 63,770,598 (GRCm39) unclassified probably benign
R5478:Fastkd2 UTSW 1 63,778,345 (GRCm39) missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63,778,469 (GRCm39) missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63,770,953 (GRCm39) missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63,771,032 (GRCm39) missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63,771,009 (GRCm39) missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63,776,948 (GRCm39) missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63,770,851 (GRCm39) missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63,774,619 (GRCm39) splice site probably null
R8263:Fastkd2 UTSW 1 63,770,968 (GRCm39) missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63,787,183 (GRCm39) missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63,787,138 (GRCm39) missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63,770,923 (GRCm39) missense probably benign 0.06
Z1177:Fastkd2 UTSW 1 63,773,996 (GRCm39) critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63,773,995 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCTTTGCTGAAATGAATTAAGGC -3'
(R):5'- GAAAGGCCCCACTTACCTATG -3'

Sequencing Primer
(F):5'- GTGTCTTTCTTAAGCTCCA -3'
(R):5'- GACAACCTTACTTATGTGGAGGTCC -3'
Posted On 2021-03-08