Incidental Mutation 'R8767:Fastkd2'
ID 667907
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8767 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63730614-63754655 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63735921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 342 (D342G)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: D342G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: D342G

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,832,716 T954A probably damaging Het
Arhgap24 A T 5: 102,891,874 M319L probably benign Het
Aste1 A G 9: 105,396,899 N113D possibly damaging Het
Ccnh C T 13: 85,208,840 Q275* probably null Het
Cfi G A 3: 129,850,848 probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Crybg3 T A 16: 59,556,137 M1585L probably benign Het
D17Wsu92e T C 17: 27,768,069 T228A probably benign Het
D630036H23Rik A G 12: 36,381,442 S186P unknown Het
Dnhd1 T C 7: 105,652,123 L229P probably damaging Het
Dtymk A T 1: 93,800,913 probably benign Het
Eif4g3 T A 4: 138,203,468 I1511K probably damaging Het
Fam189b T G 3: 89,184,418 probably benign Het
Hcar1 A G 5: 123,879,050 F193L probably damaging Het
Hivep2 T G 10: 14,129,248 L530R probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lats2 G A 14: 57,694,324 T879M probably damaging Het
Lin54 G A 5: 100,453,025 T503I probably benign Het
Mmp16 T G 4: 18,051,714 probably benign Het
Muc6 A G 7: 141,643,282 Y1186H probably damaging Het
Nr3c1 A G 18: 39,486,334 F300S probably damaging Het
Olfr1393 A G 11: 49,280,400 N84S possibly damaging Het
Olfr836 A C 9: 19,121,626 I221L possibly damaging Het
Pcdha4 T C 18: 36,953,852 S363P possibly damaging Het
Ptdss1 C T 13: 66,953,544 A99V probably benign Het
Ptprz1 T A 6: 22,986,188 L329Q probably damaging Het
Rnf115 T C 3: 96,788,591 V231A probably damaging Het
Sh3pxd2a A G 19: 47,268,906 Y486H probably damaging Het
Shh T A 5: 28,466,489 N92I possibly damaging Het
Slc13a4 T A 6: 35,268,848 I621F probably benign Het
Srrm1 T C 4: 135,332,221 T438A unknown Het
Synj1 A C 16: 90,961,518 F813V probably damaging Het
Tnrc6a A G 7: 123,183,910 probably benign Het
Trir T A 8: 85,027,061 F55I probably damaging Het
Tsr1 A G 11: 74,908,323 T777A probably damaging Het
Vmn2r5 G A 3: 64,507,682 R86C possibly damaging Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63731692 missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63735460 splice site probably null
R8263:Fastkd2 UTSW 1 63731809 missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63748024 missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63747979 missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63731764 missense probably benign 0.06
Z1177:Fastkd2 UTSW 1 63734836 critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63734837 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCTTTGCTGAAATGAATTAAGGC -3'
(R):5'- GAAAGGCCCCACTTACCTATG -3'

Sequencing Primer
(F):5'- GTGTCTTTCTTAAGCTCCA -3'
(R):5'- GACAACCTTACTTATGTGGAGGTCC -3'
Posted On 2021-03-08