Incidental Mutation 'R8767:Arhgap24'
ID667915
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8767 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102891874 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 319 (M319L)
Ref Sequence ENSEMBL: ENSMUSP00000092138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
Predicted Effect probably benign
Transcript: ENSMUST00000070000
AA Change: M229L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: M229L

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073302
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
AA Change: M319L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: M319L

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112852
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112853
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,832,716 T954A probably damaging Het
Aste1 A G 9: 105,396,899 N113D possibly damaging Het
Ccnh C T 13: 85,208,840 Q275* probably null Het
Cfi G A 3: 129,850,848 probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Crybg3 T A 16: 59,556,137 M1585L probably benign Het
D17Wsu92e T C 17: 27,768,069 T228A probably benign Het
D630036H23Rik A G 12: 36,381,442 S186P unknown Het
Dnhd1 T C 7: 105,652,123 L229P probably damaging Het
Eif4g3 T A 4: 138,203,468 I1511K probably damaging Het
Fastkd2 A G 1: 63,735,921 D342G probably benign Het
Hcar1 A G 5: 123,879,050 F193L probably damaging Het
Hivep2 T G 10: 14,129,248 L530R probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lats2 G A 14: 57,694,324 T879M probably damaging Het
Lin54 G A 5: 100,453,025 T503I probably benign Het
Muc6 A G 7: 141,643,282 Y1186H probably damaging Het
Nr3c1 A G 18: 39,486,334 F300S probably damaging Het
Olfr1393 A G 11: 49,280,400 N84S possibly damaging Het
Olfr836 A C 9: 19,121,626 I221L possibly damaging Het
Pcdha4 T C 18: 36,953,852 S363P possibly damaging Het
Ptdss1 C T 13: 66,953,544 A99V probably benign Het
Ptprz1 T A 6: 22,986,188 L329Q probably damaging Het
Rnf115 T C 3: 96,788,591 V231A probably damaging Het
Sh3pxd2a A G 19: 47,268,906 Y486H probably damaging Het
Shh T A 5: 28,466,489 N92I possibly damaging Het
Slc13a4 T A 6: 35,268,848 I621F probably benign Het
Srrm1 T C 4: 135,332,221 T438A unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Synj1 A C 16: 90,961,518 F813V probably damaging Het
Trir T A 8: 85,027,061 F55I probably damaging Het
Tsr1 A G 11: 74,908,323 T777A probably damaging Het
Vmn2r5 G A 3: 64,507,682 R86C possibly damaging Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
bullmarket UTSW 5 102875777 missense probably damaging 0.99
buyers UTSW 5 102897220 missense probably damaging 1.00
wallstreet UTSW 5 102552297 splice site probably null
BB009:Arhgap24 UTSW 5 102845969 intron probably benign
BB019:Arhgap24 UTSW 5 102845969 intron probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 splice site probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 splice site probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016 intron probably benign
R7667:Arhgap24 UTSW 5 102878457 missense probably benign
R7932:Arhgap24 UTSW 5 102845969 intron probably benign
R8227:Arhgap24 UTSW 5 102875781 missense probably benign 0.02
R8289:Arhgap24 UTSW 5 102880826 missense possibly damaging 0.88
R8431:Arhgap24 UTSW 5 102892598 missense possibly damaging 0.49
R8721:Arhgap24 UTSW 5 102875699 missense possibly damaging 0.46
Z1176:Arhgap24 UTSW 5 102875759 missense probably damaging 0.97
Z1176:Arhgap24 UTSW 5 102880807 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCACAGACTAGATACTCCAG -3'
(R):5'- TTCAGGCTTGTCCCAAGAGC -3'

Sequencing Primer
(F):5'- GACTAGATACTCCAGAAGCTGTAGC -3'
(R):5'- AAGAGCACCTTCTGACGGG -3'
Posted On2021-03-08