Incidental Mutation 'R8767:Arhgap24'
ID 667915
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene Name Rho GTPase activating protein 24
Synonyms 0610025G21Rik
MMRRC Submission 068601-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8767 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 102629257-103045803 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103039740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 319 (M319L)
Ref Sequence ENSEMBL: ENSMUSP00000092138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070000
AA Change: M229L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: M229L

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073302
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
AA Change: M319L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: M319L

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112852
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112853
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
AA Change: M226L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: M226L

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,969,224 (GRCm39) T954A probably damaging Het
Aste1 A G 9: 105,274,098 (GRCm39) N113D possibly damaging Het
Ccnh C T 13: 85,356,959 (GRCm39) Q275* probably null Het
Cfi G A 3: 129,644,497 (GRCm39) probably null Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Crybg3 T A 16: 59,376,500 (GRCm39) M1585L probably benign Het
D630036H23Rik A G 12: 36,431,441 (GRCm39) S186P unknown Het
Dnhd1 T C 7: 105,301,330 (GRCm39) L229P probably damaging Het
Dtymk A T 1: 93,728,635 (GRCm39) probably benign Het
Eif4g3 T A 4: 137,930,779 (GRCm39) I1511K probably damaging Het
Entrep3 T G 3: 89,091,725 (GRCm39) probably benign Het
Fastkd2 A G 1: 63,775,080 (GRCm39) D342G probably benign Het
Hcar1 A G 5: 124,017,113 (GRCm39) F193L probably damaging Het
Hivep2 T G 10: 14,004,992 (GRCm39) L530R probably damaging Het
Ilrun T C 17: 27,987,043 (GRCm39) T228A probably benign Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lats2 G A 14: 57,931,781 (GRCm39) T879M probably damaging Het
Lin54 G A 5: 100,600,884 (GRCm39) T503I probably benign Het
Mmp16 T G 4: 18,051,714 (GRCm39) probably benign Het
Muc6 A G 7: 141,229,549 (GRCm39) Y1186H probably damaging Het
Nr3c1 A G 18: 39,619,387 (GRCm39) F300S probably damaging Het
Or2y1g A G 11: 49,171,227 (GRCm39) N84S possibly damaging Het
Or7g21 A C 9: 19,032,922 (GRCm39) I221L possibly damaging Het
Pcdha4 T C 18: 37,086,905 (GRCm39) S363P possibly damaging Het
Ptdss1 C T 13: 67,101,608 (GRCm39) A99V probably benign Het
Ptprz1 T A 6: 22,986,187 (GRCm39) L329Q probably damaging Het
Rnf115 T C 3: 96,695,907 (GRCm39) V231A probably damaging Het
Sh3pxd2a A G 19: 47,257,345 (GRCm39) Y486H probably damaging Het
Shh T A 5: 28,671,487 (GRCm39) N92I possibly damaging Het
Slc13a4 T A 6: 35,245,783 (GRCm39) I621F probably benign Het
Srrm1 T C 4: 135,059,532 (GRCm39) T438A unknown Het
Synj1 A C 16: 90,758,406 (GRCm39) F813V probably damaging Het
Tnrc6a A G 7: 122,783,133 (GRCm39) probably benign Het
Trir T A 8: 85,753,690 (GRCm39) F55I probably damaging Het
Tsr1 A G 11: 74,799,149 (GRCm39) T777A probably damaging Het
Vmn2r5 G A 3: 64,415,103 (GRCm39) R86C possibly damaging Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 103,008,265 (GRCm39) missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 103,008,243 (GRCm39) missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 103,040,386 (GRCm39) missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 103,023,552 (GRCm39) splice site probably benign
bullmarket UTSW 5 103,023,643 (GRCm39) missense probably damaging 0.99
buyers UTSW 5 103,045,086 (GRCm39) missense probably damaging 1.00
wallstreet UTSW 5 102,700,163 (GRCm39) splice site probably null
BB009:Arhgap24 UTSW 5 102,993,835 (GRCm39) intron probably benign
BB019:Arhgap24 UTSW 5 102,993,835 (GRCm39) intron probably benign
R0506:Arhgap24 UTSW 5 103,023,643 (GRCm39) missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 103,045,086 (GRCm39) missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102,811,972 (GRCm39) missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 103,008,198 (GRCm39) missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 103,039,953 (GRCm39) missense probably benign 0.40
R2112:Arhgap24 UTSW 5 103,040,366 (GRCm39) missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 103,008,291 (GRCm39) missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 103,039,776 (GRCm39) missense probably benign
R3803:Arhgap24 UTSW 5 103,040,308 (GRCm39) missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102,811,983 (GRCm39) missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102,812,080 (GRCm39) intron probably benign
R5045:Arhgap24 UTSW 5 103,039,743 (GRCm39) missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102,989,201 (GRCm39) missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 103,040,015 (GRCm39) missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102,994,037 (GRCm39) critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102,700,025 (GRCm39) splice site probably null
R6039:Arhgap24 UTSW 5 103,028,652 (GRCm39) missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 103,028,652 (GRCm39) missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 103,040,778 (GRCm39) missense probably benign 0.12
R6410:Arhgap24 UTSW 5 103,040,017 (GRCm39) missense probably benign 0.10
R6450:Arhgap24 UTSW 5 103,044,990 (GRCm39) missense probably benign 0.01
R6520:Arhgap24 UTSW 5 103,028,659 (GRCm39) missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102,700,163 (GRCm39) splice site probably null
R7233:Arhgap24 UTSW 5 103,026,367 (GRCm39) missense probably benign 0.03
R7311:Arhgap24 UTSW 5 103,040,551 (GRCm39) missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 103,040,212 (GRCm39) missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102,989,174 (GRCm39) missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102,993,882 (GRCm39) intron probably benign
R7667:Arhgap24 UTSW 5 103,026,323 (GRCm39) missense probably benign
R7932:Arhgap24 UTSW 5 102,993,835 (GRCm39) intron probably benign
R8227:Arhgap24 UTSW 5 103,023,647 (GRCm39) missense probably benign 0.02
R8289:Arhgap24 UTSW 5 103,028,692 (GRCm39) missense possibly damaging 0.88
R8431:Arhgap24 UTSW 5 103,040,464 (GRCm39) missense possibly damaging 0.49
R8721:Arhgap24 UTSW 5 103,023,565 (GRCm39) missense possibly damaging 0.46
R8954:Arhgap24 UTSW 5 103,040,136 (GRCm39) missense probably benign 0.00
R9120:Arhgap24 UTSW 5 103,040,016 (GRCm39) missense probably benign 0.05
R9306:Arhgap24 UTSW 5 102,994,008 (GRCm39) missense possibly damaging 0.91
R9687:Arhgap24 UTSW 5 102,994,022 (GRCm39) missense probably benign
Z1176:Arhgap24 UTSW 5 103,028,673 (GRCm39) missense probably benign 0.00
Z1176:Arhgap24 UTSW 5 103,023,625 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCACAGACTAGATACTCCAG -3'
(R):5'- TTCAGGCTTGTCCCAAGAGC -3'

Sequencing Primer
(F):5'- GACTAGATACTCCAGAAGCTGTAGC -3'
(R):5'- AAGAGCACCTTCTGACGGG -3'
Posted On 2021-03-08