Incidental Mutation 'R8767:Olfr1393'
ID 667926
Institutional Source Beutler Lab
Gene Symbol Olfr1393
Ensembl Gene ENSMUSG00000059864
Gene Name olfactory receptor 1393
Synonyms MOR256-67_i, GA_x6K02T2QP88-6154577-6153642, MOR256-24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R8767 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 49278304-49282769 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49280400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 84 (N84S)
Ref Sequence ENSEMBL: ENSMUSP00000149358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078932] [ENSMUST00000213323] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
AlphaFold Q8VFA7
Predicted Effect possibly damaging
Transcript: ENSMUST00000078932
AA Change: N84S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077962
Gene: ENSMUSG00000059864
AA Change: N84S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 230 3e-6 PFAM
Pfam:7tm_1 41 289 5.8e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213323
AA Change: N84S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000214170
Predicted Effect probably benign
Transcript: ENSMUST00000214598
Predicted Effect probably benign
Transcript: ENSMUST00000215861
Predicted Effect probably benign
Transcript: ENSMUST00000217275
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,832,716 T954A probably damaging Het
Arhgap24 A T 5: 102,891,874 M319L probably benign Het
Aste1 A G 9: 105,396,899 N113D possibly damaging Het
Ccnh C T 13: 85,208,840 Q275* probably null Het
Cfi G A 3: 129,850,848 probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Crybg3 T A 16: 59,556,137 M1585L probably benign Het
D17Wsu92e T C 17: 27,768,069 T228A probably benign Het
D630036H23Rik A G 12: 36,381,442 S186P unknown Het
Dnhd1 T C 7: 105,652,123 L229P probably damaging Het
Dtymk A T 1: 93,800,913 probably benign Het
Eif4g3 T A 4: 138,203,468 I1511K probably damaging Het
Fam189b T G 3: 89,184,418 probably benign Het
Fastkd2 A G 1: 63,735,921 D342G probably benign Het
Hcar1 A G 5: 123,879,050 F193L probably damaging Het
Hivep2 T G 10: 14,129,248 L530R probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lats2 G A 14: 57,694,324 T879M probably damaging Het
Lin54 G A 5: 100,453,025 T503I probably benign Het
Mmp16 T G 4: 18,051,714 probably benign Het
Muc6 A G 7: 141,643,282 Y1186H probably damaging Het
Nr3c1 A G 18: 39,486,334 F300S probably damaging Het
Olfr836 A C 9: 19,121,626 I221L possibly damaging Het
Pcdha4 T C 18: 36,953,852 S363P possibly damaging Het
Ptdss1 C T 13: 66,953,544 A99V probably benign Het
Ptprz1 T A 6: 22,986,188 L329Q probably damaging Het
Rnf115 T C 3: 96,788,591 V231A probably damaging Het
Sh3pxd2a A G 19: 47,268,906 Y486H probably damaging Het
Shh T A 5: 28,466,489 N92I possibly damaging Het
Slc13a4 T A 6: 35,268,848 I621F probably benign Het
Srrm1 T C 4: 135,332,221 T438A unknown Het
Synj1 A C 16: 90,961,518 F813V probably damaging Het
Tnrc6a A G 7: 123,183,910 probably benign Het
Trir T A 8: 85,027,061 F55I probably damaging Het
Tsr1 A G 11: 74,908,323 T777A probably damaging Het
Vmn2r5 G A 3: 64,507,682 R86C possibly damaging Het
Other mutations in Olfr1393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Olfr1393 APN 11 49280487 missense possibly damaging 0.94
IGL02291:Olfr1393 APN 11 49280985 missense probably damaging 1.00
IGL03127:Olfr1393 APN 11 49280772 missense possibly damaging 0.88
R0580:Olfr1393 UTSW 11 49280622 missense probably damaging 0.97
R1985:Olfr1393 UTSW 11 49280283 missense probably damaging 1.00
R4812:Olfr1393 UTSW 11 49280457 missense possibly damaging 0.94
R5190:Olfr1393 UTSW 11 49280382 missense probably damaging 0.99
R6694:Olfr1393 UTSW 11 49280552 missense probably benign 0.01
R6911:Olfr1393 UTSW 11 49280807 missense probably benign 0.22
R7012:Olfr1393 UTSW 11 49280996 missense probably benign 0.07
R7159:Olfr1393 UTSW 11 49280358 missense probably damaging 1.00
R7541:Olfr1393 UTSW 11 49280333 missense probably damaging 1.00
R7759:Olfr1393 UTSW 11 49280636 missense probably benign 0.00
R9069:Olfr1393 UTSW 11 49280420 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCCTGCACTAGAACTCATC -3'
(R):5'- GAGTTCAAGAAGCCTCCTACC -3'

Sequencing Primer
(F):5'- TGCACTAGAACTCATCTTCTTTATTC -3'
(R):5'- GAAGCAATAGCCAATGCCTG -3'
Posted On 2021-03-08