Incidental Mutation 'R8767:Synj1'
ID 667935
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Name synaptojanin 1
Synonyms A930006D20Rik
MMRRC Submission 068601-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8767 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 90732980-90808196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 90758406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 813 (F813V)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853] [ENSMUST00000231472]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: F787V

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121759
AA Change: F813V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: F813V

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130813
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170853
AA Change: F773V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: F773V

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000231472
AA Change: D87E
Meta Mutation Damage Score 0.9581 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,969,224 (GRCm39) T954A probably damaging Het
Arhgap24 A T 5: 103,039,740 (GRCm39) M319L probably benign Het
Aste1 A G 9: 105,274,098 (GRCm39) N113D possibly damaging Het
Ccnh C T 13: 85,356,959 (GRCm39) Q275* probably null Het
Cfi G A 3: 129,644,497 (GRCm39) probably null Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Crybg3 T A 16: 59,376,500 (GRCm39) M1585L probably benign Het
D630036H23Rik A G 12: 36,431,441 (GRCm39) S186P unknown Het
Dnhd1 T C 7: 105,301,330 (GRCm39) L229P probably damaging Het
Dtymk A T 1: 93,728,635 (GRCm39) probably benign Het
Eif4g3 T A 4: 137,930,779 (GRCm39) I1511K probably damaging Het
Entrep3 T G 3: 89,091,725 (GRCm39) probably benign Het
Fastkd2 A G 1: 63,775,080 (GRCm39) D342G probably benign Het
Hcar1 A G 5: 124,017,113 (GRCm39) F193L probably damaging Het
Hivep2 T G 10: 14,004,992 (GRCm39) L530R probably damaging Het
Ilrun T C 17: 27,987,043 (GRCm39) T228A probably benign Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lats2 G A 14: 57,931,781 (GRCm39) T879M probably damaging Het
Lin54 G A 5: 100,600,884 (GRCm39) T503I probably benign Het
Mmp16 T G 4: 18,051,714 (GRCm39) probably benign Het
Muc6 A G 7: 141,229,549 (GRCm39) Y1186H probably damaging Het
Nr3c1 A G 18: 39,619,387 (GRCm39) F300S probably damaging Het
Or2y1g A G 11: 49,171,227 (GRCm39) N84S possibly damaging Het
Or7g21 A C 9: 19,032,922 (GRCm39) I221L possibly damaging Het
Pcdha4 T C 18: 37,086,905 (GRCm39) S363P possibly damaging Het
Ptdss1 C T 13: 67,101,608 (GRCm39) A99V probably benign Het
Ptprz1 T A 6: 22,986,187 (GRCm39) L329Q probably damaging Het
Rnf115 T C 3: 96,695,907 (GRCm39) V231A probably damaging Het
Sh3pxd2a A G 19: 47,257,345 (GRCm39) Y486H probably damaging Het
Shh T A 5: 28,671,487 (GRCm39) N92I possibly damaging Het
Slc13a4 T A 6: 35,245,783 (GRCm39) I621F probably benign Het
Srrm1 T C 4: 135,059,532 (GRCm39) T438A unknown Het
Tnrc6a A G 7: 122,783,133 (GRCm39) probably benign Het
Trir T A 8: 85,753,690 (GRCm39) F55I probably damaging Het
Tsr1 A G 11: 74,799,149 (GRCm39) T777A probably damaging Het
Vmn2r5 G A 3: 64,415,103 (GRCm39) R86C possibly damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90,748,864 (GRCm39) missense probably damaging 1.00
IGL01468:Synj1 APN 16 90,807,060 (GRCm39) splice site probably benign
IGL02209:Synj1 APN 16 90,784,307 (GRCm39) missense probably damaging 0.97
IGL02452:Synj1 APN 16 90,758,253 (GRCm39) splice site probably benign
IGL02619:Synj1 APN 16 90,770,933 (GRCm39) missense probably damaging 1.00
IGL02650:Synj1 APN 16 90,773,584 (GRCm39) missense probably benign 0.03
IGL02708:Synj1 APN 16 90,788,350 (GRCm39) missense probably damaging 1.00
IGL02863:Synj1 APN 16 90,758,322 (GRCm39) missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90,785,056 (GRCm39) missense probably damaging 0.99
IGL03295:Synj1 APN 16 90,735,318 (GRCm39) missense probably benign 0.14
IGL03356:Synj1 APN 16 90,784,280 (GRCm39) missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90,761,396 (GRCm39) missense probably damaging 1.00
R0179:Synj1 UTSW 16 90,761,519 (GRCm39) missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90,735,528 (GRCm39) missense probably benign
R0426:Synj1 UTSW 16 90,764,242 (GRCm39) missense probably damaging 1.00
R0486:Synj1 UTSW 16 90,735,151 (GRCm39) utr 3 prime probably benign
R0515:Synj1 UTSW 16 90,790,910 (GRCm39) missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90,744,975 (GRCm39) missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0698:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0945:Synj1 UTSW 16 90,757,333 (GRCm39) missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90,743,743 (GRCm39) missense probably benign 0.05
R1562:Synj1 UTSW 16 90,784,290 (GRCm39) missense probably benign 0.09
R1732:Synj1 UTSW 16 90,761,118 (GRCm39) missense probably damaging 0.99
R1752:Synj1 UTSW 16 90,735,361 (GRCm39) missense probably benign
R1785:Synj1 UTSW 16 90,761,405 (GRCm39) missense probably damaging 1.00
R1786:Synj1 UTSW 16 90,761,405 (GRCm39) missense probably damaging 1.00
R2011:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2012:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2065:Synj1 UTSW 16 90,788,537 (GRCm39) critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90,766,217 (GRCm39) missense probably damaging 1.00
R3026:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R3151:Synj1 UTSW 16 90,757,514 (GRCm39) missense probably damaging 0.96
R3946:Synj1 UTSW 16 90,806,984 (GRCm39) missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90,788,491 (GRCm39) missense probably damaging 1.00
R4472:Synj1 UTSW 16 90,766,069 (GRCm39) critical splice donor site probably null
R4547:Synj1 UTSW 16 90,785,170 (GRCm39) missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90,770,877 (GRCm39) missense probably damaging 1.00
R4739:Synj1 UTSW 16 90,752,307 (GRCm39) missense probably benign 0.00
R5027:Synj1 UTSW 16 90,737,407 (GRCm39) splice site probably null
R5428:Synj1 UTSW 16 90,788,406 (GRCm39) missense probably damaging 0.98
R5586:Synj1 UTSW 16 90,806,865 (GRCm39) intron probably benign
R5769:Synj1 UTSW 16 90,735,141 (GRCm39) utr 3 prime probably benign
R6005:Synj1 UTSW 16 90,766,174 (GRCm39) missense probably damaging 1.00
R6119:Synj1 UTSW 16 90,735,877 (GRCm39) missense probably benign 0.30
R6313:Synj1 UTSW 16 90,743,703 (GRCm39) missense probably benign 0.00
R6324:Synj1 UTSW 16 90,735,518 (GRCm39) missense probably benign 0.00
R6549:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R6696:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6698:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6861:Synj1 UTSW 16 90,760,768 (GRCm39) nonsense probably null
R7008:Synj1 UTSW 16 90,790,833 (GRCm39) missense probably damaging 1.00
R7153:Synj1 UTSW 16 90,744,978 (GRCm39) missense probably benign 0.04
R7393:Synj1 UTSW 16 90,748,887 (GRCm39) missense probably damaging 0.99
R7510:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R7560:Synj1 UTSW 16 90,737,371 (GRCm39) missense probably benign
R7724:Synj1 UTSW 16 90,758,387 (GRCm39) missense probably damaging 0.99
R7913:Synj1 UTSW 16 90,788,315 (GRCm39) missense possibly damaging 0.83
R8326:Synj1 UTSW 16 90,785,084 (GRCm39) missense probably benign 0.12
R8707:Synj1 UTSW 16 90,752,319 (GRCm39) missense probably benign 0.02
R8711:Synj1 UTSW 16 90,806,971 (GRCm39) missense probably damaging 0.98
R8911:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R9052:Synj1 UTSW 16 90,735,728 (GRCm39) missense probably benign 0.00
R9124:Synj1 UTSW 16 90,735,513 (GRCm39) missense probably benign 0.00
R9307:Synj1 UTSW 16 90,785,095 (GRCm39) missense probably damaging 0.98
R9408:Synj1 UTSW 16 90,741,740 (GRCm39) missense probably benign 0.27
R9458:Synj1 UTSW 16 90,766,200 (GRCm39) missense probably benign 0.05
R9567:Synj1 UTSW 16 90,790,912 (GRCm39) missense possibly damaging 0.79
R9651:Synj1 UTSW 16 90,757,343 (GRCm39) missense possibly damaging 0.56
R9651:Synj1 UTSW 16 90,735,412 (GRCm39) missense probably benign 0.00
R9707:Synj1 UTSW 16 90,758,300 (GRCm39) missense possibly damaging 0.91
R9730:Synj1 UTSW 16 90,757,552 (GRCm39) missense probably damaging 0.98
R9732:Synj1 UTSW 16 90,761,414 (GRCm39) missense probably damaging 1.00
Z1176:Synj1 UTSW 16 90,784,228 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCCTCCTCACAAAATGTAT -3'
(R):5'- CCTATAGGCCATGACCCACT -3'

Sequencing Primer
(F):5'- AAAGGCCACTTCCTCCTT -3'
(R):5'- CCACTGGGAGTCACATTAGGATTC -3'
Posted On 2021-03-08