Incidental Mutation 'R8767:D17Wsu92e'
ID667936
Institutional Source Beutler Lab
Gene Symbol D17Wsu92e
Ensembl Gene ENSMUSG00000056692
Gene NameDNA segment, Chr 17, Wayne State University 92, expressed
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8767 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location27751232-27820558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27768069 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 228 (T228A)
Ref Sequence ENSEMBL: ENSMUSP00000074585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075076] [ENSMUST00000114859] [ENSMUST00000114863]
Predicted Effect probably benign
Transcript: ENSMUST00000075076
AA Change: T228A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074585
Gene: ENSMUSG00000056692
AA Change: T228A

DomainStartEndE-ValueType
Pfam:UBA_4 25 68 1.6e-13 PFAM
Pfam:N_BRCA1_IG 80 179 1.6e-37 PFAM
low complexity region 257 276 N/A INTRINSIC
low complexity region 282 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114859
SMART Domains Protein: ENSMUSP00000110509
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 5.1e-15 PFAM
PDB:4OLE|D 74 180 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114863
AA Change: T228A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110513
Gene: ENSMUSG00000056692
AA Change: T228A

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 2.2e-14 PFAM
PDB:4OLE|D 74 180 8e-9 PDB
low complexity region 257 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,832,716 T954A probably damaging Het
Arhgap24 A T 5: 102,891,874 M319L probably benign Het
Aste1 A G 9: 105,396,899 N113D possibly damaging Het
Ccnh C T 13: 85,208,840 Q275* probably null Het
Cfi G A 3: 129,850,848 probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Crybg3 T A 16: 59,556,137 M1585L probably benign Het
D630036H23Rik A G 12: 36,381,442 S186P unknown Het
Dnhd1 T C 7: 105,652,123 L229P probably damaging Het
Eif4g3 T A 4: 138,203,468 I1511K probably damaging Het
Fastkd2 A G 1: 63,735,921 D342G probably benign Het
Hcar1 A G 5: 123,879,050 F193L probably damaging Het
Hivep2 T G 10: 14,129,248 L530R probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Lats2 G A 14: 57,694,324 T879M probably damaging Het
Lin54 G A 5: 100,453,025 T503I probably benign Het
Muc6 A G 7: 141,643,282 Y1186H probably damaging Het
Nr3c1 A G 18: 39,486,334 F300S probably damaging Het
Olfr1393 A G 11: 49,280,400 N84S possibly damaging Het
Olfr836 A C 9: 19,121,626 I221L possibly damaging Het
Pcdha4 T C 18: 36,953,852 S363P possibly damaging Het
Ptdss1 C T 13: 66,953,544 A99V probably benign Het
Ptprz1 T A 6: 22,986,188 L329Q probably damaging Het
Rnf115 T C 3: 96,788,591 V231A probably damaging Het
Sh3pxd2a A G 19: 47,268,906 Y486H probably damaging Het
Shh T A 5: 28,466,489 N92I possibly damaging Het
Slc13a4 T A 6: 35,268,848 I621F probably benign Het
Srrm1 T C 4: 135,332,221 T438A unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Synj1 A C 16: 90,961,518 F813V probably damaging Het
Trir T A 8: 85,027,061 F55I probably damaging Het
Tsr1 A G 11: 74,908,323 T777A probably damaging Het
Vmn2r5 G A 3: 64,507,682 R86C possibly damaging Het
Other mutations in D17Wsu92e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:D17Wsu92e APN 17 27767919 missense probably damaging 1.00
IGL01107:D17Wsu92e APN 17 27786069 critical splice donor site probably null
IGL01805:D17Wsu92e APN 17 27767906 splice site probably benign
detroit UTSW 17 27794070 splice site probably null
michigander UTSW 17 27767986 missense probably benign 0.12
R0423:D17Wsu92e UTSW 17 27786233 missense probably damaging 1.00
R0833:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R0836:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R1055:D17Wsu92e UTSW 17 27767936 missense probably damaging 1.00
R1251:D17Wsu92e UTSW 17 27786070 critical splice donor site probably null
R1646:D17Wsu92e UTSW 17 27793960 missense probably damaging 1.00
R4022:D17Wsu92e UTSW 17 27786262 missense probably damaging 0.97
R4604:D17Wsu92e UTSW 17 27820315 missense probably damaging 1.00
R5360:D17Wsu92e UTSW 17 27794046 missense probably damaging 1.00
R6210:D17Wsu92e UTSW 17 27767986 missense probably benign 0.12
R7201:D17Wsu92e UTSW 17 27794070 splice site probably null
R7994:D17Wsu92e UTSW 17 27767943 missense probably benign
R8057:D17Wsu92e UTSW 17 27767889 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCATTGTAGGTTTGCCACG -3'
(R):5'- AGATGTCATCTGGGTGATTCTC -3'

Sequencing Primer
(F):5'- GTTTGCCACGAAGAAGTGTC -3'
(R):5'- CATCTGGGTGATTCTCAGTGTGGAG -3'
Posted On2021-03-08