Incidental Mutation 'R8767:Ilrun'
ID 667936
Institutional Source Beutler Lab
Gene Symbol Ilrun
Ensembl Gene ENSMUSG00000056692
Gene Name inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms D17Wsu92e
MMRRC Submission 068601-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8767 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 27970206-28039516 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27987043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 228 (T228A)
Ref Sequence ENSEMBL: ENSMUSP00000074585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075076] [ENSMUST00000114859] [ENSMUST00000114863]
AlphaFold Q3TT38
Predicted Effect probably benign
Transcript: ENSMUST00000075076
AA Change: T228A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074585
Gene: ENSMUSG00000056692
AA Change: T228A

DomainStartEndE-ValueType
Pfam:UBA_4 25 68 1.6e-13 PFAM
Pfam:N_BRCA1_IG 80 179 1.6e-37 PFAM
low complexity region 257 276 N/A INTRINSIC
low complexity region 282 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114859
SMART Domains Protein: ENSMUSP00000110509
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 5.1e-15 PFAM
PDB:4OLE|D 74 180 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114863
AA Change: T228A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110513
Gene: ENSMUSG00000056692
AA Change: T228A

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 2.2e-14 PFAM
PDB:4OLE|D 74 180 8e-9 PDB
low complexity region 257 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd31 A G 13: 96,969,224 (GRCm39) T954A probably damaging Het
Arhgap24 A T 5: 103,039,740 (GRCm39) M319L probably benign Het
Aste1 A G 9: 105,274,098 (GRCm39) N113D possibly damaging Het
Ccnh C T 13: 85,356,959 (GRCm39) Q275* probably null Het
Cfi G A 3: 129,644,497 (GRCm39) probably null Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Crybg3 T A 16: 59,376,500 (GRCm39) M1585L probably benign Het
D630036H23Rik A G 12: 36,431,441 (GRCm39) S186P unknown Het
Dnhd1 T C 7: 105,301,330 (GRCm39) L229P probably damaging Het
Dtymk A T 1: 93,728,635 (GRCm39) probably benign Het
Eif4g3 T A 4: 137,930,779 (GRCm39) I1511K probably damaging Het
Entrep3 T G 3: 89,091,725 (GRCm39) probably benign Het
Fastkd2 A G 1: 63,775,080 (GRCm39) D342G probably benign Het
Hcar1 A G 5: 124,017,113 (GRCm39) F193L probably damaging Het
Hivep2 T G 10: 14,004,992 (GRCm39) L530R probably damaging Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Lats2 G A 14: 57,931,781 (GRCm39) T879M probably damaging Het
Lin54 G A 5: 100,600,884 (GRCm39) T503I probably benign Het
Mmp16 T G 4: 18,051,714 (GRCm39) probably benign Het
Muc6 A G 7: 141,229,549 (GRCm39) Y1186H probably damaging Het
Nr3c1 A G 18: 39,619,387 (GRCm39) F300S probably damaging Het
Or2y1g A G 11: 49,171,227 (GRCm39) N84S possibly damaging Het
Or7g21 A C 9: 19,032,922 (GRCm39) I221L possibly damaging Het
Pcdha4 T C 18: 37,086,905 (GRCm39) S363P possibly damaging Het
Ptdss1 C T 13: 67,101,608 (GRCm39) A99V probably benign Het
Ptprz1 T A 6: 22,986,187 (GRCm39) L329Q probably damaging Het
Rnf115 T C 3: 96,695,907 (GRCm39) V231A probably damaging Het
Sh3pxd2a A G 19: 47,257,345 (GRCm39) Y486H probably damaging Het
Shh T A 5: 28,671,487 (GRCm39) N92I possibly damaging Het
Slc13a4 T A 6: 35,245,783 (GRCm39) I621F probably benign Het
Srrm1 T C 4: 135,059,532 (GRCm39) T438A unknown Het
Synj1 A C 16: 90,758,406 (GRCm39) F813V probably damaging Het
Tnrc6a A G 7: 122,783,133 (GRCm39) probably benign Het
Trir T A 8: 85,753,690 (GRCm39) F55I probably damaging Het
Tsr1 A G 11: 74,799,149 (GRCm39) T777A probably damaging Het
Vmn2r5 G A 3: 64,415,103 (GRCm39) R86C possibly damaging Het
Other mutations in Ilrun
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Ilrun APN 17 27,986,893 (GRCm39) missense probably damaging 1.00
IGL01107:Ilrun APN 17 28,005,043 (GRCm39) critical splice donor site probably null
IGL01805:Ilrun APN 17 27,986,880 (GRCm39) splice site probably benign
detroit UTSW 17 28,013,044 (GRCm39) splice site probably null
michigander UTSW 17 27,986,960 (GRCm39) missense probably benign 0.12
R0423:Ilrun UTSW 17 28,005,207 (GRCm39) missense probably damaging 1.00
R0833:Ilrun UTSW 17 28,005,112 (GRCm39) missense probably damaging 1.00
R0836:Ilrun UTSW 17 28,005,112 (GRCm39) missense probably damaging 1.00
R1055:Ilrun UTSW 17 27,986,910 (GRCm39) missense probably damaging 1.00
R1251:Ilrun UTSW 17 28,005,044 (GRCm39) critical splice donor site probably null
R1646:Ilrun UTSW 17 28,012,934 (GRCm39) missense probably damaging 1.00
R4022:Ilrun UTSW 17 28,005,236 (GRCm39) missense probably damaging 0.97
R4604:Ilrun UTSW 17 28,039,289 (GRCm39) missense probably damaging 1.00
R5360:Ilrun UTSW 17 28,013,020 (GRCm39) missense probably damaging 1.00
R6210:Ilrun UTSW 17 27,986,960 (GRCm39) missense probably benign 0.12
R7201:Ilrun UTSW 17 28,013,044 (GRCm39) splice site probably null
R7994:Ilrun UTSW 17 27,986,917 (GRCm39) missense probably benign
R8057:Ilrun UTSW 17 27,986,863 (GRCm39) missense unknown
R9269:Ilrun UTSW 17 28,005,049 (GRCm39) nonsense probably null
R9629:Ilrun UTSW 17 28,012,913 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCATTGTAGGTTTGCCACG -3'
(R):5'- AGATGTCATCTGGGTGATTCTC -3'

Sequencing Primer
(F):5'- GTTTGCCACGAAGAAGTGTC -3'
(R):5'- CATCTGGGTGATTCTCAGTGTGGAG -3'
Posted On 2021-03-08