Incidental Mutation 'R8777-TAIL:Olfr248'
ID668091
Institutional Source Beutler Lab
Gene Symbol Olfr248
Ensembl Gene ENSMUSG00000059503
Gene Nameolfactory receptor 248
SynonymsGA_x6K02T2P20D-20771141-20770212, GA_x6K02T2MFC0-1145-1312, MOR267-7, Olfr415
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8777-TAIL
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174391046-174392055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 174391282 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 71 (Y71F)
Ref Sequence ENSEMBL: ENSMUSP00000074799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075329]
Predicted Effect probably damaging
Transcript: ENSMUST00000075329
AA Change: Y71F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074799
Gene: ENSMUSG00000059503
AA Change: Y71F

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.2e-40 PFAM
Pfam:7tm_1 39 303 7.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,427 I1621R probably damaging Het
Abcb4 A T 5: 8,939,894 T816S probably benign Het
Aff4 G A 11: 53,399,956 S581N probably damaging Het
Aimp2 G A 5: 143,903,007 A253V probably damaging Het
Arl6ip4 T G 5: 124,116,548 S35A probably benign Het
Atp1a4 A T 1: 172,232,302 Y787N probably damaging Het
Ccdc169 T C 3: 55,150,913 S13P probably damaging Het
Ccdc186 G A 19: 56,813,361 S108F probably damaging Het
Ccdc39 G A 3: 33,839,133 T101I probably benign Het
Cdh13 G T 8: 119,236,967 probably null Het
Clec1b A T 6: 129,403,574 E151V probably benign Het
Cplx1 T A 5: 108,525,569 probably null Het
Diablo T A 5: 123,517,927 I150F unknown Het
Esp31 T C 17: 38,644,691 V75A probably benign Het
Gm49336 G A 14: 60,228,736 L458F probably damaging Het
Grin3b A T 10: 79,973,138 S241C possibly damaging Het
Gxylt2 A G 6: 100,750,471 N182S probably damaging Het
Hephl1 T G 9: 15,060,794 D950A probably benign Het
Hkdc1 A G 10: 62,398,833 I556T possibly damaging Het
Ints4 C A 7: 97,485,020 A53D probably damaging Het
Kmt5c T C 7: 4,742,713 V124A possibly damaging Het
Lrpprc T A 17: 84,751,229 Q734H probably benign Het
Map1b T C 13: 99,430,796 T1806A unknown Het
Mcmbp A T 7: 128,707,131 F389I probably damaging Het
Mcrs1 C T 15: 99,243,356 G422S probably damaging Het
Mgam A G 6: 40,655,251 H173R probably damaging Het
Mib1 G A 18: 10,747,422 G200S probably benign Het
Myh13 A T 11: 67,361,335 Q1423L possibly damaging Het
Myh2 A G 11: 67,192,572 R1454G possibly damaging Het
Mylk4 C T 13: 32,729,106 V70I probably benign Het
Myof A G 19: 37,980,393 V358A probably benign Het
Ncor1 T A 11: 62,433,666 I48F probably benign Het
Ncor1 T A 11: 62,433,668 H47L probably damaging Het
Neurog2 G T 3: 127,634,093 R122L probably damaging Het
Npdc1 T A 2: 25,408,117 L193Q probably damaging Het
Nrxn3 A G 12: 89,260,464 N290D probably damaging Het
Nynrin T C 14: 55,871,663 M1409T probably benign Het
Oas1h T C 5: 120,867,044 L185P probably damaging Het
Olfr30 C T 11: 58,455,931 W6* probably null Het
Olfr788 T A 10: 129,473,505 V271E possibly damaging Het
Osbpl8 T A 10: 111,293,113 N853K probably benign Het
Papd7 T A 13: 69,510,705 D337V probably damaging Het
Pcsk4 G T 10: 80,323,723 P405Q probably benign Het
Piwil4 A C 9: 14,739,389 probably null Het
Pkhd1l1 T C 15: 44,498,571 Y547H probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rft1 T C 14: 30,660,199 L51P probably damaging Het
Rufy2 T G 10: 62,997,881 L241V possibly damaging Het
Slc5a5 T C 8: 70,891,290 I155V possibly damaging Het
Slc7a2 T G 8: 40,898,954 M18R probably damaging Het
Snapc4 A G 2: 26,369,363 S592P probably benign Het
Strn4 T C 7: 16,816,608 W86R probably damaging Het
Tenm4 A G 7: 96,896,037 N2457S probably damaging Het
Timd4 C A 11: 46,815,482 T37N possibly damaging Het
Tmem268 T A 4: 63,577,839 N172K probably damaging Het
Trrap T A 5: 144,837,139 V2855D probably benign Het
Tubb6 A T 18: 67,401,528 T166S probably damaging Het
Tufm A G 7: 126,488,862 Y179C probably benign Het
Ube2r2 C T 4: 41,190,715 S203L possibly damaging Het
Vldlr G T 19: 27,240,546 V465L probably benign Het
Vmn2r16 C T 5: 109,340,365 T368M probably benign Het
Vmn2r42 A G 7: 8,192,693 F485L probably benign Het
Zcchc6 T C 13: 59,785,783 N1302D probably benign Het
Other mutations in Olfr248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Olfr248 APN 1 174391408 missense probably damaging 1.00
R0375:Olfr248 UTSW 1 174391209 missense probably damaging 1.00
R1720:Olfr248 UTSW 1 174391920 missense probably benign 0.00
R1906:Olfr248 UTSW 1 174391164 missense probably damaging 1.00
R1996:Olfr248 UTSW 1 174391417 missense probably damaging 1.00
R2009:Olfr248 UTSW 1 174391429 missense possibly damaging 0.94
R4745:Olfr248 UTSW 1 174391876 missense probably damaging 1.00
R5294:Olfr248 UTSW 1 174391225 missense probably benign
R5297:Olfr248 UTSW 1 174391200 missense probably benign 0.21
R5665:Olfr248 UTSW 1 174391375 missense probably damaging 1.00
R5784:Olfr248 UTSW 1 174391399 missense probably damaging 1.00
R5857:Olfr248 UTSW 1 174391108 missense possibly damaging 0.59
R6943:Olfr248 UTSW 1 174391841 nonsense probably null
R6975:Olfr248 UTSW 1 174391677 missense probably benign 0.10
R7114:Olfr248 UTSW 1 174391239 missense probably damaging 0.96
R7614:Olfr248 UTSW 1 174391654 missense probably damaging 0.99
R8036:Olfr248 UTSW 1 174391816 missense probably damaging 1.00
R8674:Olfr248 UTSW 1 174391692 missense probably damaging 1.00
R8777:Olfr248 UTSW 1 174391282 missense probably damaging 1.00
Predicted Primers
Posted On2021-03-08