Incidental Mutation 'R8777-TAIL:Myh13'
ID668136
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R8777-TAIL
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67361335 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1423 (Q1423L)
Ref Sequence ENSEMBL: ENSMUSP00000080584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081911
AA Change: Q1423L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: Q1423L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108684
AA Change: Q1423L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: Q1423L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180845
AA Change: Q1423L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: Q1423L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181027
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,427 I1621R probably damaging Het
Abcb4 A T 5: 8,939,894 T816S probably benign Het
Aff4 G A 11: 53,399,956 S581N probably damaging Het
Aimp2 G A 5: 143,903,007 A253V probably damaging Het
Arl6ip4 T G 5: 124,116,548 S35A probably benign Het
Atp1a4 A T 1: 172,232,302 Y787N probably damaging Het
Ccdc169 T C 3: 55,150,913 S13P probably damaging Het
Ccdc186 G A 19: 56,813,361 S108F probably damaging Het
Ccdc39 G A 3: 33,839,133 T101I probably benign Het
Cdh13 G T 8: 119,236,967 probably null Het
Clec1b A T 6: 129,403,574 E151V probably benign Het
Cplx1 T A 5: 108,525,569 probably null Het
Diablo T A 5: 123,517,927 I150F unknown Het
Esp31 T C 17: 38,644,691 V75A probably benign Het
Gm49336 G A 14: 60,228,736 L458F probably damaging Het
Grin3b A T 10: 79,973,138 S241C possibly damaging Het
Gxylt2 A G 6: 100,750,471 N182S probably damaging Het
Hephl1 T G 9: 15,060,794 D950A probably benign Het
Hkdc1 A G 10: 62,398,833 I556T possibly damaging Het
Ints4 C A 7: 97,485,020 A53D probably damaging Het
Kmt5c T C 7: 4,742,713 V124A possibly damaging Het
Lrpprc T A 17: 84,751,229 Q734H probably benign Het
Map1b T C 13: 99,430,796 T1806A unknown Het
Mcmbp A T 7: 128,707,131 F389I probably damaging Het
Mcrs1 C T 15: 99,243,356 G422S probably damaging Het
Mgam A G 6: 40,655,251 H173R probably damaging Het
Mib1 G A 18: 10,747,422 G200S probably benign Het
Myh2 A G 11: 67,192,572 R1454G possibly damaging Het
Mylk4 C T 13: 32,729,106 V70I probably benign Het
Myof A G 19: 37,980,393 V358A probably benign Het
Ncor1 T A 11: 62,433,666 I48F probably benign Het
Ncor1 T A 11: 62,433,668 H47L probably damaging Het
Neurog2 G T 3: 127,634,093 R122L probably damaging Het
Npdc1 T A 2: 25,408,117 L193Q probably damaging Het
Nrxn3 A G 12: 89,260,464 N290D probably damaging Het
Nynrin T C 14: 55,871,663 M1409T probably benign Het
Oas1h T C 5: 120,867,044 L185P probably damaging Het
Olfr248 A T 1: 174,391,282 Y71F probably damaging Het
Olfr30 C T 11: 58,455,931 W6* probably null Het
Olfr788 T A 10: 129,473,505 V271E possibly damaging Het
Osbpl8 T A 10: 111,293,113 N853K probably benign Het
Papd7 T A 13: 69,510,705 D337V probably damaging Het
Pcsk4 G T 10: 80,323,723 P405Q probably benign Het
Piwil4 A C 9: 14,739,389 probably null Het
Pkhd1l1 T C 15: 44,498,571 Y547H probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rft1 T C 14: 30,660,199 L51P probably damaging Het
Rufy2 T G 10: 62,997,881 L241V possibly damaging Het
Slc5a5 T C 8: 70,891,290 I155V possibly damaging Het
Slc7a2 T G 8: 40,898,954 M18R probably damaging Het
Snapc4 A G 2: 26,369,363 S592P probably benign Het
Strn4 T C 7: 16,816,608 W86R probably damaging Het
Tenm4 A G 7: 96,896,037 N2457S probably damaging Het
Timd4 C A 11: 46,815,482 T37N possibly damaging Het
Tmem268 T A 4: 63,577,839 N172K probably damaging Het
Trrap T A 5: 144,837,139 V2855D probably benign Het
Tubb6 A T 18: 67,401,528 T166S probably damaging Het
Tufm A G 7: 126,488,862 Y179C probably benign Het
Ube2r2 C T 4: 41,190,715 S203L possibly damaging Het
Vldlr G T 19: 27,240,546 V465L probably benign Het
Vmn2r16 C T 5: 109,340,365 T368M probably benign Het
Vmn2r42 A G 7: 8,192,693 F485L probably benign Het
Zcchc6 T C 13: 59,785,783 N1302D probably benign Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers
Posted On2021-03-08