Mutagenetix > Incidental Mutation

Incidental Mutation 'R8777-TAIL:Map1b'

668141

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8777-TAIL

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99430796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1806 (T1806A)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: T1806A

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T1806A

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	G	5: 107,510,427	I1621R	probably damaging	Het
Abcb4	A	T	5: 8,939,894	T816S	probably benign	Het
Aff4	G	A	11: 53,399,956	S581N	probably damaging	Het
Aimp2	G	A	5: 143,903,007	A253V	probably damaging	Het
Arl6ip4	T	G	5: 124,116,548	S35A	probably benign	Het
Atp1a4	A	T	1: 172,232,302	Y787N	probably damaging	Het
Ccdc169	T	C	3: 55,150,913	S13P	probably damaging	Het
Ccdc186	G	A	19: 56,813,361	S108F	probably damaging	Het
Ccdc39	G	A	3: 33,839,133	T101I	probably benign	Het
Cdh13	G	T	8: 119,236,967		probably null	Het
Clec1b	A	T	6: 129,403,574	E151V	probably benign	Het
Cplx1	T	A	5: 108,525,569		probably null	Het
Diablo	T	A	5: 123,517,927	I150F	unknown	Het
Esp31	T	C	17: 38,644,691	V75A	probably benign	Het
Gm49336	G	A	14: 60,228,736	L458F	probably damaging	Het
Grin3b	A	T	10: 79,973,138	S241C	possibly damaging	Het
Gxylt2	A	G	6: 100,750,471	N182S	probably damaging	Het
Hephl1	T	G	9: 15,060,794	D950A	probably benign	Het
Hkdc1	A	G	10: 62,398,833	I556T	possibly damaging	Het
Ints4	C	A	7: 97,485,020	A53D	probably damaging	Het
Kmt5c	T	C	7: 4,742,713	V124A	possibly damaging	Het
Lrpprc	T	A	17: 84,751,229	Q734H	probably benign	Het
Mcmbp	A	T	7: 128,707,131	F389I	probably damaging	Het
Mcrs1	C	T	15: 99,243,356	G422S	probably damaging	Het
Mgam	A	G	6: 40,655,251	H173R	probably damaging	Het
Mib1	G	A	18: 10,747,422	G200S	probably benign	Het
Myh13	A	T	11: 67,361,335	Q1423L	possibly damaging	Het
Myh2	A	G	11: 67,192,572	R1454G	possibly damaging	Het
Mylk4	C	T	13: 32,729,106	V70I	probably benign	Het
Myof	A	G	19: 37,980,393	V358A	probably benign	Het
Ncor1	T	A	11: 62,433,666	I48F	probably benign	Het
Ncor1	T	A	11: 62,433,668	H47L	probably damaging	Het
Neurog2	G	T	3: 127,634,093	R122L	probably damaging	Het
Npdc1	T	A	2: 25,408,117	L193Q	probably damaging	Het
Nrxn3	A	G	12: 89,260,464	N290D	probably damaging	Het
Nynrin	T	C	14: 55,871,663	M1409T	probably benign	Het
Oas1h	T	C	5: 120,867,044	L185P	probably damaging	Het
Olfr248	A	T	1: 174,391,282	Y71F	probably damaging	Het
Olfr30	C	T	11: 58,455,931	W6*	probably null	Het
Olfr788	T	A	10: 129,473,505	V271E	possibly damaging	Het
Osbpl8	T	A	10: 111,293,113	N853K	probably benign	Het
Papd7	T	A	13: 69,510,705	D337V	probably damaging	Het
Pcsk4	G	T	10: 80,323,723	P405Q	probably benign	Het
Piwil4	A	C	9: 14,739,389		probably null	Het
Pkhd1l1	T	C	15: 44,498,571	Y547H	probably damaging	Het
Prr36	TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC	TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC	8: 4,216,273		probably benign	Het
Rft1	T	C	14: 30,660,199	L51P	probably damaging	Het
Rufy2	T	G	10: 62,997,881	L241V	possibly damaging	Het
Slc5a5	T	C	8: 70,891,290	I155V	possibly damaging	Het
Slc7a2	T	G	8: 40,898,954	M18R	probably damaging	Het
Snapc4	A	G	2: 26,369,363	S592P	probably benign	Het
Strn4	T	C	7: 16,816,608	W86R	probably damaging	Het
Tenm4	A	G	7: 96,896,037	N2457S	probably damaging	Het
Timd4	C	A	11: 46,815,482	T37N	possibly damaging	Het
Tmem268	T	A	4: 63,577,839	N172K	probably damaging	Het
Trrap	T	A	5: 144,837,139	V2855D	probably benign	Het
Tubb6	A	T	18: 67,401,528	T166S	probably damaging	Het
Tufm	A	G	7: 126,488,862	Y179C	probably benign	Het
Ube2r2	C	T	4: 41,190,715	S203L	possibly damaging	Het
Vldlr	G	T	19: 27,240,546	V465L	probably benign	Het
Vmn2r16	C	T	5: 109,340,365	T368M	probably benign	Het
Vmn2r42	A	G	7: 8,192,693	F485L	probably benign	Het
Zcchc6	T	C	13: 59,785,783	N1302D	probably benign	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

Posted On

2021-03-08