Incidental Mutation 'R8481:Got2'
ID 668161
Institutional Source Beutler Lab
Gene Symbol Got2
Ensembl Gene ENSMUSG00000031672
Gene Name glutamatic-oxaloacetic transaminase 2, mitochondrial
Synonyms FABP-pm, Got-2, plasma membrane fatty acid binding protein, mitochondrial aspartate aminotransferase, mAspAT
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock # R8481 (G1)
Quality Score 78.0075
Status Validated
Chromosome 8
Chromosomal Location 95864134-95888547 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) T to A at 95888524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034097]
AlphaFold P05202
PDB Structure Crystal Structure of Mouse Mitochondrial Aspartate Aminotransferase/Kynurenine Aminotransferase IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase in complex with oxaloacetic acid [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034097
SMART Domains Protein: ENSMUSP00000034097
Gene: ENSMUSG00000031672

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:Aminotran_1_2 57 425 4.8e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Ccdc88b A T 19: 6,854,532 L427Q probably damaging Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Dpp9 C A 17: 56,194,467 D582Y possibly damaging Het
Evi2 T A 11: 79,515,462 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Prlhr A G 19: 60,467,687 V147A possibly damaging Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rabep1 T C 11: 70,887,127 S162P probably damaging Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Sec24d T A 3: 123,353,424 L677H probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tex36 A T 7: 133,587,460 S128T probably damaging Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Got2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Got2 APN 8 95872201 missense probably benign 0.06
Toothpick UTSW 8 95872268 missense probably benign 0.20
R0189:Got2 UTSW 8 95888253 missense probably benign 0.11
R0254:Got2 UTSW 8 95869538 missense probably benign 0.03
R1450:Got2 UTSW 8 95871986 missense probably benign 0.00
R1552:Got2 UTSW 8 95869494 missense probably benign 0.22
R2495:Got2 UTSW 8 95888290 missense possibly damaging 0.81
R3946:Got2 UTSW 8 95888230 missense probably benign
R4021:Got2 UTSW 8 95877753 missense probably damaging 1.00
R4594:Got2 UTSW 8 95872186 missense probably benign 0.15
R5087:Got2 UTSW 8 95872323 missense probably benign 0.00
R5233:Got2 UTSW 8 95875849 missense probably benign 0.33
R6156:Got2 UTSW 8 95872268 missense probably benign 0.20
R6529:Got2 UTSW 8 95888385 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATGGTGGTAGAGCCGAGATCTG -3'
(R):5'- CACTTGGGGAAACTAGTGGG -3'

Sequencing Primer
(F):5'- AGATCTGGGGAAGCGTCC -3'
(R):5'- TCTAGCGTAGCGGATGAT -3'
Posted On 2021-03-10