Incidental Mutation 'R8463:Pcca'
ID668166
Institutional Source Beutler Lab
Gene Symbol Pcca
Ensembl Gene ENSMUSG00000041650
Gene Namepropionyl-Coenzyme A carboxylase, alpha polypeptide
SynonymsC79630
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8463 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location122534324-122891100 bp(+) (GRCm38)
Type of Mutationsplice site (89 bp from exon)
DNA Base Change (assembly) A to G at 122685114 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038374]
Predicted Effect probably null
Transcript: ENSMUST00000038374
SMART Domains Protein: ENSMUSP00000038763
Gene: ENSMUSG00000041650

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 167 2.1e-48 PFAM
Pfam:ATP-grasp_4 169 351 3.8e-15 PFAM
Pfam:RimK 170 372 5.6e-7 PFAM
Pfam:CPSase_L_D2 172 381 2.8e-87 PFAM
Pfam:ATP-grasp 181 351 9.8e-10 PFAM
Pfam:Dala_Dala_lig_C 192 349 7.7e-12 PFAM
Biotin_carb_C 393 501 4.27e-46 SMART
Pfam:Biotin_lipoyl 656 723 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177312
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice die 24-36 hours after birth due to accelerated ketoacidosis. Death is preceded by reduced milk intake, poor movement, dehydration, accumulation of propionyl-CoA, ketonuria, increased fat deposition and glycogen consumption in liver, and enlarged kidney collecting ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,281,612 I146F probably damaging Het
Adcy8 G T 15: 64,921,025 D27E probably benign Het
Ahnak A G 19: 9,008,749 I2466V probably benign Het
BC005624 T A 2: 30,981,805 E19V possibly damaging Het
Bnc2 A T 4: 84,293,371 F279I probably damaging Het
Bub1 A T 2: 127,817,433 L335M probably benign Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cdkn1c G A 7: 143,460,587 H41Y possibly damaging Het
Celsr1 G A 15: 86,030,214 P1186L probably damaging Het
Cnot2 A G 10: 116,517,331 L75S probably benign Het
Cntn6 A T 6: 104,772,619 E338D possibly damaging Het
Dlg2 G T 7: 91,968,233 M289I probably benign Het
Dzip1l A T 9: 99,637,822 D134V possibly damaging Het
Fam171b A G 2: 83,853,457 Y106C probably damaging Het
Fgd3 T C 13: 49,266,605 K599E possibly damaging Het
Gabrr2 A T 4: 33,084,375 I154F probably damaging Het
Gjd2 T A 2: 114,011,572 E141D probably benign Het
Gmds T C 13: 31,819,923 N371S probably benign Het
Gp2 C T 7: 119,454,331 A136T probably damaging Het
Gstm2 A G 3: 107,986,356 probably null Het
Hnmt T C 2: 24,048,824 M1V probably null Het
Hydin T C 8: 110,510,921 V1942A probably benign Het
Krt87 C A 15: 101,434,625 A236S probably benign Het
Lama3 A T 18: 12,449,839 H654L probably damaging Het
Lrp2 G A 2: 69,491,906 T1893M probably damaging Het
Lyg1 A T 1: 37,949,841 Y99* probably null Het
Mdga1 T C 17: 29,849,729 D208G probably damaging Het
Mgarp T C 3: 51,388,927 E218G probably damaging Het
Mif4gd T A 11: 115,608,498 D186V probably benign Het
Mlec T C 5: 115,150,224 Y191C probably damaging Het
Mtus1 C A 8: 41,083,234 V482L probably benign Het
Muc16 T A 9: 18,659,139 T695S unknown Het
Muc4 A T 16: 32,752,401 M760L probably benign Het
Mybl2 A T 2: 163,074,718 S430C probably damaging Het
Nepn A G 10: 52,400,800 N211D probably benign Het
Nuggc A G 14: 65,613,562 T294A probably damaging Het
Olfr1140 A T 2: 87,747,093 E299V probably benign Het
Olfr633 G A 7: 103,946,627 probably null Het
Pcdhb13 T G 18: 37,443,234 S222A possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plppr3 A T 10: 79,867,563 V29E probably damaging Het
Plxna2 C T 1: 194,644,046 P96L probably damaging Het
Pop4 A T 7: 38,263,175 *222R probably null Het
Prss2 T A 6: 41,521,805 M1K probably null Het
Prss3 C A 6: 41,375,125 R68L probably benign Het
Recql5 G A 11: 115,896,793 Q512* probably null Het
Rnf148 A G 6: 23,654,802 I65T probably benign Het
Scgb1b19 G A 7: 33,287,657 A78T probably benign Het
Sftpd A G 14: 41,175,626 probably null Het
Shank1 A G 7: 44,354,181 R1766G possibly damaging Het
Slc35e2 T C 4: 155,610,158 L54P probably damaging Het
Smg6 A G 11: 74,930,060 K386E probably benign Het
Sorcs1 A G 19: 50,259,810 S393P probably damaging Het
Spen A G 4: 141,522,279 V66A unknown Het
Tpm1 G T 9: 67,048,230 A45E probably benign Het
Trmt2a T C 16: 18,251,175 Y294H probably damaging Het
Txnl4b T C 8: 109,572,798 V130A possibly damaging Het
Vmn2r14 C A 5: 109,221,474 V78L probably benign Het
Vmn2r27 A G 6: 124,192,209 V654A probably damaging Het
Wee2 G T 6: 40,443,980 M1I probably null Het
Xpnpep3 A G 15: 81,448,471 K403R probably benign Het
Zranb1 A G 7: 132,950,081 T154A possibly damaging Het
Other mutations in Pcca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pcca APN 14 122582629 missense probably benign 0.22
IGL00906:Pcca APN 14 122690133 missense probably benign 0.34
IGL00975:Pcca APN 14 122876900 missense probably damaging 1.00
IGL01329:Pcca APN 14 122690133 missense possibly damaging 0.50
IGL01353:Pcca APN 14 122582617 missense probably damaging 0.98
IGL01672:Pcca APN 14 122690145 missense probably benign 0.02
IGL02621:Pcca APN 14 122684979 missense probably damaging 0.99
IGL02695:Pcca APN 14 122582738 splice site probably benign
IGL02749:Pcca APN 14 122534388 missense probably benign 0.00
IGL02971:Pcca APN 14 122889533 missense probably damaging 0.96
IGL03290:Pcca APN 14 122585106 missense possibly damaging 0.52
IGL03052:Pcca UTSW 14 122887101 missense probably benign
PIT4812001:Pcca UTSW 14 122790382 missense probably benign 0.00
R0549:Pcca UTSW 14 122638377 splice site probably benign
R0866:Pcca UTSW 14 122889545 missense possibly damaging 0.95
R1498:Pcca UTSW 14 122616818 missense probably damaging 1.00
R1749:Pcca UTSW 14 122701130 missense probably damaging 0.97
R2002:Pcca UTSW 14 122887065 missense probably benign 0.00
R2020:Pcca UTSW 14 122813222 missense possibly damaging 0.64
R2086:Pcca UTSW 14 122686115 missense probably damaging 0.99
R3780:Pcca UTSW 14 122684885 missense probably damaging 1.00
R5023:Pcca UTSW 14 122790398 missense probably damaging 1.00
R5643:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5644:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5943:Pcca UTSW 14 122658776 missense probably damaging 0.99
R5966:Pcca UTSW 14 122668586 missense probably damaging 0.96
R6295:Pcca UTSW 14 122658775 missense probably benign 0.10
R6317:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6319:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6361:Pcca UTSW 14 122638382 missense probably benign 0.07
R6989:Pcca UTSW 14 122650288 missense probably damaging 1.00
R7243:Pcca UTSW 14 122876774 missense probably benign
R7841:Pcca UTSW 14 122562972 missense probably benign 0.03
R8026:Pcca UTSW 14 122638382 missense probably benign 0.07
R8769:Pcca UTSW 14 122616848 missense probably benign 0.01
R8956:Pcca UTSW 14 122737912 missense probably benign
RF024:Pcca UTSW 14 122684898 missense probably damaging 1.00
X0026:Pcca UTSW 14 122616791 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CATTACTGGCCTGGACTTAGTC -3'
(R):5'- CAGTGTAGAGCCTGTCTGTG -3'

Sequencing Primer
(F):5'- GTCCAAGAAATGATCCTTGTTGC -3'
(R):5'- CTGTGGAATTTTGAAGGACAAAGTC -3'
Posted On2021-03-10