Mutagenetix > Incidental Mutation

Incidental Mutation 'R8544:Trpm1'

668169

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8544 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 64224608 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

probably null
Transcript: ENSMUST00000085222

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177102

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

probably null
Transcript: ENSMUST00000206263

Predicted Effect

probably null
Transcript: ENSMUST00000206277

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	C	A	15: 37,425,735		probably benign	Het
A430105I19Rik	C	T	2: 118,757,221	R544K	unknown	Het
Abcb5	A	T	12: 118,868,726	L1171H	probably damaging	Het
Ace	A	T	11: 105,971,290		probably null	Het
Adsl	G	T	15: 80,948,533		probably benign	Het
Cabin1	A	G	10: 75,750,056	M215T	probably benign	Het
Cabp2	A	T	19: 4,084,892	R77S	probably damaging	Het
Cast	A	T	13: 74,734,058	H40Q	possibly damaging	Het
Ccar1	A	T	10: 62,750,579	Y946N	unknown	Het
Chst14	A	G	2: 118,927,529	Y268C	probably damaging	Het
Dennd1a	T	C	2: 37,982,908		probably null	Het
Dnah1	A	G	14: 31,268,904	Y3153H	probably damaging	Het
Entpd8	T	C	2: 25,083,844	V271A	probably benign	Het
Eppk1	C	T	15: 76,110,119	R854Q	probably benign	Het
Fam126b	T	C	1: 58,529,822	T477A	probably benign	Het
Fam234b	A	G	6: 135,233,289	Y561C	probably damaging	Het
Flg	A	G	3: 93,288,141		probably benign	Het
Galnt5	T	A	2: 58,017,148	M541K	probably damaging	Het
Gjd3	C	A	11: 98,982,662	E119*	probably null	Het
Gm266	T	C	12: 111,485,365	T136A	possibly damaging	Het
Gng11	G	A	6: 4,008,045	C36Y	possibly damaging	Het
Gse1	G	A	8: 120,553,652	V36I	probably damaging	Het
Invs	A	T	4: 48,397,598	H335L	probably damaging	Het
Kcnc2	A	T	10: 112,456,196	I28F	probably damaging	Het
Klhl40	C	T	9: 121,778,826	H351Y	probably damaging	Het
Kremen2	A	G	17: 23,742,227	L382P	probably benign	Het
Lenep	A	T	3: 89,402,477	C55S	possibly damaging	Het
Lrp12	A	T	15: 39,878,574	Y248*	probably null	Het
Man2c1	A	G	9: 57,131,041		probably null	Het
Map2k2	T	C	10: 81,119,542	M32T	possibly damaging	Het
Mnt	A	G	11: 74,831,392	R22G	probably damaging	Het
Mroh1	G	T	15: 76,443,358	E1127*	probably null	Het
Mtmr4	A	G	11: 87,611,909	R930G	possibly damaging	Het
Nalcn	A	G	14: 123,371,523	V644A	probably benign	Het
Ngf	G	T	3: 102,520,675	V247F	probably damaging	Het
Ninj2	A	G	6: 120,198,057	Y63C	probably damaging	Het
Olfr1226	T	C	2: 89,193,968	E22G	possibly damaging	Het
Olfr577	A	T	7: 102,973,731	I87N	probably damaging	Het
Phf12	A	C	11: 78,027,409	I816L	probably damaging	Het
Pkhd1	C	A	1: 20,522,975	G1638V	probably damaging	Het
Plce1	T	A	19: 38,524,459	S67R	probably benign	Het
Plekhf1	A	G	7: 38,221,344	F267L	probably damaging	Het
Poc1b	A	T	10: 99,124,908	K60*	probably null	Het
Ppic	G	A	18: 53,411,540	T66M	probably damaging	Het
Prep	G	T	10: 45,153,127	G541V	probably damaging	Het
Rasal3	C	T	17: 32,392,119	V947I	probably benign	Het
Rbl1	T	C	2: 157,193,204	R319G	probably damaging	Het
Rbm34	A	G	8: 126,970,071	S94P	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Sacm1l	T	C	9: 123,577,058		probably null	Het
Scaf8	T	C	17: 3,163,020		probably benign	Het
Scrn1	T	A	6: 54,522,856	T215S	probably benign	Het
Sfrp4	A	G	13: 19,632,166		probably null	Het
Slc37a3	T	C	6: 39,344,363	I406V	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Sptbn1	C	A	11: 30,219,750		probably benign	Het
St8sia5	T	C	18: 77,254,418	Y275H	probably damaging	Het
Stab1	A	T	14: 31,163,051	C137*	probably null	Het
Svep1	A	G	4: 58,206,025	S118P	probably benign	Het
Tbx6	A	G	7: 126,781,484		probably null	Het
Tril	C	T	6: 53,819,310	S309N	possibly damaging	Het
Trmt13	A	G	3: 116,592,445		probably null	Het
Tyr	T	C	7: 87,492,792	T110A	probably benign	Het
Upf1	A	C	8: 70,337,052	F711C	probably damaging	Het
Usp5	A	T	6: 124,823,517	V267D	probably damaging	Het
Virma	C	A	4: 11,516,949	D714E	probably benign	Het
Vmn2r115	A	C	17: 23,345,799	Q220P	possibly damaging	Het
Vmn2r40	T	C	7: 8,908,192	I701V		Het
Vwde	T	A	6: 13,187,653	M612L	probably benign	Het
Wwox	A	G	8: 114,488,906	T140A	probably benign	Het
Zbtb17	CCCCCACCTCCACAGACCCCA	CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA	4: 141,466,828		probably benign	Het
Zbtb9	T	A	17: 26,974,474	C284*	probably null	Het
Zdhhc12	C	A	2: 30,093,474	A39S	probably benign	Het
Zfp532	T	A	18: 65,625,156	I720K	possibly damaging	Het
Zfp595	G	A	13: 67,317,180	R340C	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CACAGTTTGTACAGAGAGCGAG -3'
(R):5'- GCGTGTGTGCACAAACCAG -3'

Sequencing Primer
(F):5'- GAGCCTCGTTTGGTTCTACTTACAAG -3'
(R):5'- TCAGCCAATTCATCTAAGATTTTGG -3'

Posted On

2021-03-10