Incidental Mutation 'R8480:Dlec1'
ID 668178
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Name deleted in lung and esophageal cancer 1
Synonyms D630005C06Rik
MMRRC Submission 067924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8480 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 118931546-118977314 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 118972335 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000140326] [ENSMUST00000165231]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000010795
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140326
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165231
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b G A 15: 101,108,720 (GRCm39) V499M possibly damaging Het
Adam5 G A 8: 25,294,475 (GRCm39) Q375* probably null Het
Adgrf1 G A 17: 43,606,055 (GRCm39) E60K probably benign Het
Alb T C 5: 90,610,630 (GRCm39) V70A probably damaging Het
Aph1b T A 9: 66,695,709 (GRCm39) probably benign Het
Aste1 G A 9: 105,274,189 (GRCm39) R143Q possibly damaging Het
Aste1 A T 9: 105,274,995 (GRCm39) T351S probably damaging Het
Bace2 T A 16: 97,214,670 (GRCm39) L286Q probably damaging Het
Bach1 G A 16: 87,516,163 (GRCm39) G235R probably damaging Het
Bpnt2 C T 4: 4,769,376 (GRCm39) M246I probably benign Het
Brwd1 A T 16: 95,848,630 (GRCm39) H516Q probably damaging Het
Cc2d2a C A 5: 43,842,486 (GRCm39) probably null Het
Cdh22 T A 2: 164,988,646 (GRCm39) E236D probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Col11a1 A G 3: 113,975,043 (GRCm39) D1234G probably benign Het
Cplane1 C A 15: 8,216,942 (GRCm39) P720Q possibly damaging Het
Cpt2 A G 4: 107,764,957 (GRCm39) I269T probably damaging Het
Dcaf7 T A 11: 105,945,619 (GRCm39) S323T probably benign Het
Ddias G T 7: 92,508,608 (GRCm39) Q436K probably benign Het
Dock5 T A 14: 68,073,859 (GRCm39) I294F probably benign Het
Fat2 A T 11: 55,173,794 (GRCm39) D2306E possibly damaging Het
Gm4787 T A 12: 81,424,280 (GRCm39) D626V probably damaging Het
Gm6563 A G 19: 23,653,290 (GRCm39) T27A probably benign Het
Hadhb T C 5: 30,373,568 (GRCm39) probably null Het
Hsph1 A T 5: 149,551,029 (GRCm39) W406R probably null Het
Ighv1-66 C T 12: 115,557,002 (GRCm39) G27R possibly damaging Het
Krt26 T C 11: 99,228,426 (GRCm39) E102G probably damaging Het
Krt34 T A 11: 99,930,971 (GRCm39) probably null Het
Krt36 T C 11: 99,993,635 (GRCm39) D401G possibly damaging Het
Loxhd1 G A 18: 77,518,827 (GRCm39) G326S probably damaging Het
Lrrc8b A G 5: 105,633,802 (GRCm39) N758S probably damaging Het
Mrtfb A T 16: 13,202,056 (GRCm39) probably null Het
Muc4 C T 16: 32,574,421 (GRCm39) T957I probably benign Het
Naip5 T C 13: 100,358,743 (GRCm39) Y831C probably damaging Het
Nfatc1 A T 18: 80,678,859 (GRCm39) V829E probably benign Het
Nmnat1 G A 4: 149,557,827 (GRCm39) L72F possibly damaging Het
Or4f14d A T 2: 111,960,330 (GRCm39) D275E possibly damaging Het
Pcdh7 T A 5: 58,286,407 (GRCm39) V1161E probably damaging Het
Raver1 A G 9: 21,001,576 (GRCm39) Y86H probably benign Het
Recql4 G T 15: 76,588,705 (GRCm39) H1035Q probably benign Het
Sgsm1 A T 5: 113,411,284 (GRCm39) M814K probably benign Het
Sh3d19 T G 3: 85,992,184 (GRCm39) W71G probably benign Het
Sidt1 T C 16: 44,065,529 (GRCm39) Y759C probably damaging Het
Spg11 G T 2: 121,943,560 (GRCm39) D197E probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Ssc5d A T 7: 4,939,328 (GRCm39) D588V probably damaging Het
Supt20 C A 3: 54,614,537 (GRCm39) T181K probably damaging Het
Szt2 A T 4: 118,244,015 (GRCm39) S1363R probably benign Het
Tbcel G A 9: 42,375,169 (GRCm39) probably null Het
Ube2e3 T C 2: 78,749,158 (GRCm39) L169P probably damaging Het
Wrn A G 8: 33,778,796 (GRCm39) F595S probably benign Het
Zfp473 G T 7: 44,382,323 (GRCm39) P670Q probably damaging Het
Zw10 C T 9: 48,986,299 (GRCm39) A660V probably benign Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 118,931,853 (GRCm39) missense probably benign 0.11
IGL01137:Dlec1 APN 9 118,966,379 (GRCm39) missense probably damaging 1.00
IGL01338:Dlec1 APN 9 118,949,979 (GRCm39) missense probably damaging 1.00
IGL01652:Dlec1 APN 9 118,972,975 (GRCm39) missense probably benign 0.01
IGL01923:Dlec1 APN 9 118,957,182 (GRCm39) splice site probably null
IGL02186:Dlec1 APN 9 118,972,695 (GRCm39) missense probably benign 0.00
IGL02597:Dlec1 APN 9 118,963,604 (GRCm39) missense probably damaging 0.99
IGL02667:Dlec1 APN 9 118,956,534 (GRCm39) missense probably benign 0.23
IGL02718:Dlec1 APN 9 118,966,354 (GRCm39) missense probably benign 0.01
IGL02731:Dlec1 APN 9 118,976,188 (GRCm39) missense probably benign 0.00
IGL02831:Dlec1 APN 9 118,972,983 (GRCm39) missense probably damaging 1.00
IGL03390:Dlec1 APN 9 118,952,288 (GRCm39) missense probably benign 0.00
I2288:Dlec1 UTSW 9 118,972,669 (GRCm39) missense probably damaging 1.00
R0109:Dlec1 UTSW 9 118,934,892 (GRCm39) missense probably damaging 1.00
R0144:Dlec1 UTSW 9 118,971,934 (GRCm39) missense probably benign
R0554:Dlec1 UTSW 9 118,944,070 (GRCm39) missense probably benign 0.44
R0611:Dlec1 UTSW 9 118,941,167 (GRCm39) missense probably benign 0.01
R1344:Dlec1 UTSW 9 118,959,085 (GRCm39) missense probably benign 0.09
R1467:Dlec1 UTSW 9 118,971,646 (GRCm39) missense probably damaging 1.00
R1467:Dlec1 UTSW 9 118,971,646 (GRCm39) missense probably damaging 1.00
R1467:Dlec1 UTSW 9 118,957,071 (GRCm39) splice site probably benign
R1539:Dlec1 UTSW 9 118,956,518 (GRCm39) missense probably benign 0.00
R1768:Dlec1 UTSW 9 118,975,075 (GRCm39) splice site probably null
R1809:Dlec1 UTSW 9 118,965,767 (GRCm39) missense probably benign 0.00
R1830:Dlec1 UTSW 9 118,967,858 (GRCm39) missense probably benign 0.00
R1901:Dlec1 UTSW 9 118,931,712 (GRCm39) missense probably damaging 0.99
R2060:Dlec1 UTSW 9 118,941,154 (GRCm39) missense probably damaging 1.00
R2092:Dlec1 UTSW 9 118,950,912 (GRCm39) missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 118,967,259 (GRCm39) critical splice donor site probably null
R2983:Dlec1 UTSW 9 118,975,241 (GRCm39) missense probably benign 0.00
R3117:Dlec1 UTSW 9 118,972,971 (GRCm39) splice site probably null
R3816:Dlec1 UTSW 9 118,953,911 (GRCm39) missense probably damaging 1.00
R3826:Dlec1 UTSW 9 118,972,129 (GRCm39) splice site probably benign
R3965:Dlec1 UTSW 9 118,957,649 (GRCm39) missense probably benign 0.01
R4023:Dlec1 UTSW 9 118,966,408 (GRCm39) missense probably damaging 0.98
R4024:Dlec1 UTSW 9 118,966,408 (GRCm39) missense probably damaging 0.98
R4026:Dlec1 UTSW 9 118,966,408 (GRCm39) missense probably damaging 0.98
R4272:Dlec1 UTSW 9 118,972,231 (GRCm39) missense probably damaging 0.98
R4545:Dlec1 UTSW 9 118,957,146 (GRCm39) missense probably damaging 0.99
R4546:Dlec1 UTSW 9 118,957,146 (GRCm39) missense probably damaging 0.99
R4601:Dlec1 UTSW 9 118,976,202 (GRCm39) critical splice donor site probably null
R4695:Dlec1 UTSW 9 118,972,221 (GRCm39) missense probably benign 0.00
R4996:Dlec1 UTSW 9 118,975,118 (GRCm39) missense probably damaging 1.00
R5321:Dlec1 UTSW 9 118,941,669 (GRCm39) missense probably benign 0.02
R5521:Dlec1 UTSW 9 118,972,469 (GRCm39) missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 118,972,662 (GRCm39) nonsense probably null
R5825:Dlec1 UTSW 9 118,972,036 (GRCm39) missense probably damaging 1.00
R5941:Dlec1 UTSW 9 118,955,380 (GRCm39) missense probably damaging 0.98
R6056:Dlec1 UTSW 9 118,950,991 (GRCm39) missense probably damaging 0.98
R6111:Dlec1 UTSW 9 118,931,692 (GRCm39) missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 118,939,281 (GRCm39) critical splice donor site probably null
R6160:Dlec1 UTSW 9 118,972,387 (GRCm39) missense probably benign 0.02
R6195:Dlec1 UTSW 9 118,966,321 (GRCm39) missense probably benign 0.00
R6364:Dlec1 UTSW 9 118,950,939 (GRCm39) missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 118,976,758 (GRCm39) missense probably benign 0.34
R6808:Dlec1 UTSW 9 118,955,242 (GRCm39) missense probably benign 0.01
R6813:Dlec1 UTSW 9 118,941,170 (GRCm39) missense probably benign 0.02
R7019:Dlec1 UTSW 9 118,941,490 (GRCm39) missense probably benign 0.01
R7048:Dlec1 UTSW 9 118,972,472 (GRCm39) splice site probably null
R7187:Dlec1 UTSW 9 118,941,214 (GRCm39) missense probably benign 0.14
R7230:Dlec1 UTSW 9 118,953,606 (GRCm39) splice site probably null
R7585:Dlec1 UTSW 9 118,971,819 (GRCm39) missense probably benign 0.06
R8342:Dlec1 UTSW 9 118,968,457 (GRCm39) missense probably benign 0.01
R8481:Dlec1 UTSW 9 118,972,335 (GRCm39) splice site probably null
R8485:Dlec1 UTSW 9 118,957,659 (GRCm39) missense probably benign 0.33
R8520:Dlec1 UTSW 9 118,941,277 (GRCm39) missense probably benign 0.00
R8556:Dlec1 UTSW 9 118,955,289 (GRCm39) missense probably benign 0.13
R8755:Dlec1 UTSW 9 118,967,225 (GRCm39) missense probably damaging 1.00
R8805:Dlec1 UTSW 9 118,941,650 (GRCm39) missense probably benign
R8813:Dlec1 UTSW 9 118,956,498 (GRCm39) missense probably benign 0.16
R8983:Dlec1 UTSW 9 118,957,419 (GRCm39) missense probably benign 0.00
R9040:Dlec1 UTSW 9 118,950,985 (GRCm39) missense probably benign 0.04
R9085:Dlec1 UTSW 9 118,953,252 (GRCm39) missense probably damaging 1.00
R9452:Dlec1 UTSW 9 118,941,541 (GRCm39) missense probably benign 0.05
R9467:Dlec1 UTSW 9 118,971,652 (GRCm39) missense probably damaging 1.00
R9612:Dlec1 UTSW 9 118,956,533 (GRCm39) missense probably damaging 0.98
Z1176:Dlec1 UTSW 9 118,967,854 (GRCm39) missense probably benign 0.13
Z1177:Dlec1 UTSW 9 118,976,477 (GRCm39) missense probably damaging 0.99
Z1177:Dlec1 UTSW 9 118,963,541 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CGAGGCTACTGTGTTCCTTC -3'
(R):5'- TCTCTCAAAGAGGACAGGGG -3'

Sequencing Primer
(F):5'- TCCAGGTCATCCCAGCTG -3'
(R):5'- GCAGGGGAGGGAGGTCC -3'
Posted On 2021-03-19