Incidental Mutation 'R8477:Chn2'
ID 668182
Institutional Source Beutler Lab
Gene Symbol Chn2
Ensembl Gene ENSMUSG00000004633
Gene Name chimerin 2
Synonyms 1700026N20Rik, 4930557O16Rik
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 54016917-54278797 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 54246467 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000067741] [ENSMUST00000114401] [ENSMUST00000114402] [ENSMUST00000146114] [ENSMUST00000203091] [ENSMUST00000203941] [ENSMUST00000204115] [ENSMUST00000204746] [ENSMUST00000204921]
AlphaFold Q80XD1
Predicted Effect probably null
Transcript: ENSMUST00000046856
SMART Domains Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
C1 215 264 1.88e-15 SMART
RhoGAP 288 465 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067741
SMART Domains Protein: ENSMUSP00000066078
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 1.88e-15 SMART
RhoGAP 152 329 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114401
SMART Domains Protein: ENSMUSP00000110043
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 274 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114402
SMART Domains Protein: ENSMUSP00000110044
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 224 2.07e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146114
SMART Domains Protein: ENSMUSP00000114476
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 29 78 1.88e-15 SMART
RhoGAP 102 279 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203091
SMART Domains Protein: ENSMUSP00000145008
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
Pfam:RhoGAP 155 196 5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203941
SMART Domains Protein: ENSMUSP00000145314
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
RhoGAP 101 225 1.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204115
SMART Domains Protein: ENSMUSP00000145507
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 101 257 3.7e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204746
SMART Domains Protein: ENSMUSP00000144983
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
RhoGAP 101 271 4.7e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204921
SMART Domains Protein: ENSMUSP00000145231
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 152 283 4.9e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Chn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chn2 APN 6 54,272,907 (GRCm39) critical splice donor site probably null
IGL02158:Chn2 APN 6 54,277,230 (GRCm39) unclassified probably benign
IGL02618:Chn2 APN 6 54,197,422 (GRCm39) missense probably damaging 1.00
IGL02807:Chn2 APN 6 54,272,898 (GRCm39) missense possibly damaging 0.80
IGL03357:Chn2 APN 6 54,171,062 (GRCm39) missense probably benign 0.02
R0002:Chn2 UTSW 6 54,250,098 (GRCm39) missense probably benign 0.08
R0123:Chn2 UTSW 6 54,267,436 (GRCm39) splice site probably benign
R0225:Chn2 UTSW 6 54,267,436 (GRCm39) splice site probably benign
R1478:Chn2 UTSW 6 54,270,065 (GRCm39) missense probably damaging 1.00
R1905:Chn2 UTSW 6 54,263,106 (GRCm39) missense probably damaging 1.00
R3769:Chn2 UTSW 6 54,267,396 (GRCm39) missense probably damaging 1.00
R3946:Chn2 UTSW 6 54,246,411 (GRCm39) unclassified probably benign
R4125:Chn2 UTSW 6 54,249,963 (GRCm39) missense probably damaging 1.00
R4127:Chn2 UTSW 6 54,249,963 (GRCm39) missense probably damaging 1.00
R4128:Chn2 UTSW 6 54,249,963 (GRCm39) missense probably damaging 1.00
R4614:Chn2 UTSW 6 54,267,388 (GRCm39) missense probably damaging 1.00
R4616:Chn2 UTSW 6 54,267,388 (GRCm39) missense probably damaging 1.00
R5063:Chn2 UTSW 6 54,267,272 (GRCm39) nonsense probably null
R5121:Chn2 UTSW 6 54,195,546 (GRCm39) missense possibly damaging 0.57
R5208:Chn2 UTSW 6 54,272,786 (GRCm39) missense probably damaging 0.97
R5240:Chn2 UTSW 6 54,197,680 (GRCm39) missense probably benign
R5348:Chn2 UTSW 6 54,277,203 (GRCm39) missense probably damaging 0.99
R5861:Chn2 UTSW 6 54,267,359 (GRCm39) missense probably damaging 1.00
R6539:Chn2 UTSW 6 54,150,446 (GRCm39) splice site probably null
R6824:Chn2 UTSW 6 54,249,938 (GRCm39) missense probably benign 0.00
R7194:Chn2 UTSW 6 54,263,162 (GRCm39) splice site probably null
R7740:Chn2 UTSW 6 54,277,156 (GRCm39) missense probably benign 0.18
R7765:Chn2 UTSW 6 54,275,137 (GRCm39) critical splice donor site probably null
R7997:Chn2 UTSW 6 54,267,270 (GRCm39) missense probably damaging 1.00
R8804:Chn2 UTSW 6 54,250,061 (GRCm39) missense probably benign 0.01
R9297:Chn2 UTSW 6 54,272,840 (GRCm39) missense probably damaging 1.00
R9318:Chn2 UTSW 6 54,272,840 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCCGTTGCATATTGATAGCTG -3'
(R):5'- TGCTGAATACTACCCGGCTTG -3'

Sequencing Primer
(F):5'- GATAGCTGCACTTAACTGCCTAGG -3'
(R):5'- GGGCCTGTGCTAAATACATCTCATG -3'
Posted On 2021-03-24