Incidental Mutation 'R8495:Rad9b'
ID668189
Institutional Source Beutler Lab
Gene Symbol Rad9b
Ensembl Gene ENSMUSG00000038569
Gene NameRAD9 checkpoint clamp component B
SynonymsA630082N15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8495 (G1)
Quality Score92.0077
Status Validated
Chromosome5
Chromosomal Location122323223-122354233 bp(-) (GRCm38)
Type of Mutationsplice site (6699 bp from exon)
DNA Base Change (assembly) T to C at 122333033 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000049009] [ENSMUST00000117263]
Predicted Effect probably null
Transcript: ENSMUST00000049009
SMART Domains Protein: ENSMUSP00000036177
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.8e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117263
SMART Domains Protein: ENSMUSP00000113868
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.1e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149600
SMART Domains Protein: ENSMUSP00000120843
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 85 4.3e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, decreased forebrain and somite cell proliferation, and increased cellular sensitivity to gamma irradiation and mitomycin C. Mice heterozygous for a knock-out allele exhibit reduced embryonic, fetal, and early postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,229,410 M1I probably null Het
4931423N10Rik A G 2: 23,207,840 E10G probably benign Het
5730480H06Rik A G 5: 48,379,357 T132A possibly damaging Het
Abcb1b T G 5: 8,865,865 V1249G probably damaging Het
Cdc5l A G 17: 45,426,523 L103P probably damaging Het
Clrn2 G T 5: 45,460,143 A119S possibly damaging Het
Cop1 A T 1: 159,250,030 H145L probably benign Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dennd4a A G 9: 64,886,879 E660G probably damaging Het
Dhx34 T C 7: 16,218,547 Y51C probably benign Het
Dnah5 A G 15: 28,409,268 I3611V probably damaging Het
Dock2 A T 11: 34,231,622 L1647Q probably benign Het
Dpy19l4 G A 4: 11,267,659 T427M probably benign Het
Eef2k T C 7: 120,887,880 L417P probably benign Het
Eng A G 2: 32,678,894 S477G probably benign Het
Enox1 T C 14: 77,632,572 I424T probably benign Het
Faim2 A G 15: 99,510,592 V253A probably benign Het
Farp2 A G 1: 93,603,417 I546V possibly damaging Het
Fcgbp T G 7: 28,086,553 Y472D probably damaging Het
Gm43302 A T 5: 105,276,704 C357S possibly damaging Het
Gm47189 T C 14: 41,770,096 T75A probably damaging Het
Mms22l A G 4: 24,496,908 M1V probably null Het
Myo3a A T 2: 22,396,273 I618F probably damaging Het
Nqo2 T C 13: 33,981,494 F125L probably damaging Het
Olfr1494 T A 19: 13,749,229 M41K possibly damaging Het
Pdcd6ip G A 9: 113,689,707 H162Y probably benign Het
Robo3 A G 9: 37,425,368 F368S probably damaging Het
Rsph4a G A 10: 33,905,492 A113T probably benign Het
Smc2 A T 4: 52,450,992 N270I probably benign Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Spsb4 A G 9: 96,995,569 probably null Het
Spta1 G A 1: 174,215,485 R1399Q probably benign Het
Stab1 T C 14: 31,155,833 D749G probably damaging Het
Tas2r115 A T 6: 132,737,924 N21K probably damaging Het
Tbkbp1 A G 11: 97,146,603 V221A probably benign Het
Tln2 G T 9: 67,354,467 N663K probably benign Het
Tmprss11g A T 5: 86,492,260 I170K probably benign Het
Tnfrsf21 G A 17: 43,038,237 E247K probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Vmn1r204 G A 13: 22,556,709 C170Y probably damaging Het
Vwa8 G T 14: 78,937,177 E349* probably null Het
Xpo7 A G 14: 70,670,549 probably null Het
Other mutations in Rad9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Rad9b APN 5 122344247 missense probably benign 0.01
IGL02375:Rad9b APN 5 122333342 missense possibly damaging 0.71
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0975:Rad9b UTSW 5 122334257 splice site probably null
R2006:Rad9b UTSW 5 122339779 missense possibly damaging 0.74
R2265:Rad9b UTSW 5 122351342 missense probably damaging 0.98
R4818:Rad9b UTSW 5 122339776 missense probably damaging 1.00
R5392:Rad9b UTSW 5 122351578 missense probably damaging 1.00
R6041:Rad9b UTSW 5 122351352 missense probably damaging 0.99
R6109:Rad9b UTSW 5 122344297 missense probably damaging 1.00
R6133:Rad9b UTSW 5 122339768 missense possibly damaging 0.79
R6566:Rad9b UTSW 5 122352567 missense probably damaging 1.00
R6695:Rad9b UTSW 5 122351691 missense probably damaging 1.00
R7295:Rad9b UTSW 5 122334278 missense possibly damaging 0.95
R7299:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
R7301:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
Z1088:Rad9b UTSW 5 122333372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGAAAGCTTTATGAGGTCATG -3'
(R):5'- TCCCAGGCACGAAGGTAATG -3'

Sequencing Primer
(F):5'- AGGTCATGAGAATGCATGCTTTC -3'
(R):5'- AAGGACAGTACCAGGTGTTAGTTTTC -3'
Posted On2021-04-05