Incidental Mutation 'R8688:Dsel'
ID 668220
Institutional Source Beutler Lab
Gene Symbol Dsel
Ensembl Gene ENSMUSG00000038702
Gene Name dermatan sulfate epimerase-like
Synonyms DS-epi2, 9330132E09Rik
MMRRC Submission 068543-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R8688 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 111786432-111792648 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 111790468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 22 (C22*)
Ref Sequence ENSEMBL: ENSMUSP00000043570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035462]
AlphaFold Q0VBN2
Predicted Effect probably null
Transcript: ENSMUST00000035462
AA Change: C22*
SMART Domains Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: C22*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 817 N/A INTRINSIC
Pfam:Sulfotransfer_1 847 1201 2.1e-12 PFAM
Pfam:Sulfotransfer_3 848 1143 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 144,982,183 (GRCm39) T256I probably damaging Het
2700097O09Rik C T 12: 55,104,136 (GRCm39) G161D probably damaging Het
Acvr1 G A 2: 58,352,961 (GRCm39) A333V probably damaging Het
Adamtsl1 A C 4: 86,166,263 (GRCm39) S209R Het
Akr1c18 T C 13: 4,187,194 (GRCm39) K207E possibly damaging Het
Anapc1 T G 2: 128,527,748 (GRCm39) Q70P probably benign Het
Arhgef33 A G 17: 80,680,615 (GRCm39) E585G probably damaging Het
Baz1b T G 5: 135,271,343 (GRCm39) S1309A probably benign Het
Bdp1 T C 13: 100,240,307 (GRCm39) R14G probably damaging Het
Bltp1 T A 3: 37,090,066 (GRCm39) Y745N Het
Ccdc150 A C 1: 54,407,132 (GRCm39) Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,298,510 (GRCm39) F74S probably damaging Het
CK137956 C T 4: 127,844,739 (GRCm39) E335K possibly damaging Het
Cyp2c66 A T 19: 39,151,884 (GRCm39) I200F probably benign Het
Dmbt1 T A 7: 130,659,984 (GRCm39) W412R unknown Het
Ep400 A G 5: 110,868,685 (GRCm39) M949T unknown Het
Gcc1 A T 6: 28,418,739 (GRCm39) Y531* probably null Het
Gm10277 T C 11: 77,676,405 (GRCm39) R189G unknown Het
Gm17078 T A 14: 51,848,687 (GRCm39) R17* probably null Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Grip1 A G 10: 119,835,809 (GRCm39) I502V probably benign Het
H2-M9 A T 17: 36,953,034 (GRCm39) V91D probably damaging Het
Hcls1 T C 16: 36,781,821 (GRCm39) L310P probably benign Het
Hsd17b11 T A 5: 104,169,584 (GRCm39) I8F probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Ildr2 A T 1: 166,097,102 (GRCm39) D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,608 (GRCm39) probably benign Het
Josd2 T C 7: 44,120,640 (GRCm39) W126R probably damaging Het
Ltbp2 T A 12: 84,850,578 (GRCm39) D912V probably benign Het
Mdc1 A G 17: 36,161,383 (GRCm39) I765M probably benign Het
Mroh1 A G 15: 76,312,550 (GRCm39) E579G probably benign Het
Nmur2 T C 11: 55,931,654 (GRCm39) N19S probably damaging Het
Obscn T C 11: 58,946,909 (GRCm39) Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or4k40 C T 2: 111,250,958 (GRCm39) V113I probably benign Het
Or8b51 T A 9: 38,569,047 (GRCm39) I214L probably benign Het
Orm1 G A 4: 63,264,578 (GRCm39) V167M probably damaging Het
Phf14 A G 6: 11,990,034 (GRCm39) N688D probably damaging Het
Phlpp2 A G 8: 110,631,012 (GRCm39) K219E probably damaging Het
Prdm2 T C 4: 142,838,310 (GRCm39) T1683A probably benign Het
Ptprh T A 7: 4,554,022 (GRCm39) Q815L probably benign Het
Rag1 A T 2: 101,472,968 (GRCm39) Y725N probably damaging Het
Rp1 T A 1: 4,416,628 (GRCm39) I1495F probably benign Het
Scn3a A G 2: 65,356,047 (GRCm39) V229A possibly damaging Het
Siglech A G 7: 55,418,362 (GRCm39) D110G probably benign Het
St8sia2 A T 7: 73,593,092 (GRCm39) D321E probably damaging Het
Stxbp3 A G 3: 108,709,425 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,641,208 (GRCm39) S390T possibly damaging Het
Tg T A 15: 66,566,802 (GRCm39) probably benign Het
Trio T A 15: 27,748,324 (GRCm39) N2443Y possibly damaging Het
Ube2s C T 7: 4,813,577 (GRCm39) M62I probably benign Het
Ugt2b37 T C 5: 87,390,240 (GRCm39) D402G possibly damaging Het
Vmn2r80 A G 10: 79,004,069 (GRCm39) N94S probably damaging Het
Wapl T A 14: 34,414,549 (GRCm39) S470R possibly damaging Het
Xrra1 A G 7: 99,555,752 (GRCm39) E373G probably damaging Het
Zfp335 A G 2: 164,734,113 (GRCm39) Y1329H probably damaging Het
Zfp689 C A 7: 127,044,084 (GRCm39) C182F probably benign Het
Zfp933 T A 4: 147,911,249 (GRCm39) S116C probably benign Het
Other mutations in Dsel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dsel APN 1 111,787,791 (GRCm39) nonsense probably null
IGL01562:Dsel APN 1 111,788,049 (GRCm39) missense probably benign
IGL01591:Dsel APN 1 111,787,425 (GRCm39) missense probably benign 0.08
IGL01822:Dsel APN 1 111,789,626 (GRCm39) missense probably damaging 1.00
IGL02289:Dsel APN 1 111,787,832 (GRCm39) nonsense probably null
IGL02557:Dsel APN 1 111,790,300 (GRCm39) missense probably damaging 1.00
IGL02805:Dsel APN 1 111,790,046 (GRCm39) missense probably damaging 1.00
IGL02864:Dsel APN 1 111,786,944 (GRCm39) missense probably damaging 1.00
IGL02887:Dsel APN 1 111,788,462 (GRCm39) missense possibly damaging 0.90
IGL03092:Dsel APN 1 111,787,793 (GRCm39) missense probably damaging 1.00
IGL03117:Dsel APN 1 111,786,908 (GRCm39) utr 3 prime probably benign
IGL03182:Dsel APN 1 111,787,868 (GRCm39) missense probably damaging 0.99
rudolph UTSW 1 111,787,547 (GRCm39) missense probably damaging 0.99
R0196:Dsel UTSW 1 111,789,333 (GRCm39) missense possibly damaging 0.86
R0465:Dsel UTSW 1 111,789,992 (GRCm39) missense probably benign 0.00
R0725:Dsel UTSW 1 111,787,682 (GRCm39) missense possibly damaging 0.79
R1024:Dsel UTSW 1 111,788,403 (GRCm39) missense probably damaging 1.00
R1147:Dsel UTSW 1 111,789,939 (GRCm39) missense possibly damaging 0.71
R1147:Dsel UTSW 1 111,789,939 (GRCm39) missense possibly damaging 0.71
R1654:Dsel UTSW 1 111,790,242 (GRCm39) missense probably damaging 1.00
R1728:Dsel UTSW 1 111,787,724 (GRCm39) missense probably benign
R1728:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R1729:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R1729:Dsel UTSW 1 111,787,724 (GRCm39) missense probably benign
R1730:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R1730:Dsel UTSW 1 111,787,724 (GRCm39) missense probably benign
R1735:Dsel UTSW 1 111,788,645 (GRCm39) missense probably damaging 1.00
R1739:Dsel UTSW 1 111,787,724 (GRCm39) missense probably benign
R1739:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R1762:Dsel UTSW 1 111,787,724 (GRCm39) missense probably benign
R1762:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R1783:Dsel UTSW 1 111,787,724 (GRCm39) missense probably benign
R1783:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R1785:Dsel UTSW 1 111,787,724 (GRCm39) missense probably benign
R1785:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R2049:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R2080:Dsel UTSW 1 111,787,692 (GRCm39) missense probably benign
R2141:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R2142:Dsel UTSW 1 111,787,187 (GRCm39) missense probably benign
R2150:Dsel UTSW 1 111,787,987 (GRCm39) missense probably benign 0.04
R4324:Dsel UTSW 1 111,789,123 (GRCm39) missense probably damaging 1.00
R5378:Dsel UTSW 1 111,790,551 (GRCm39) start gained probably benign
R5881:Dsel UTSW 1 111,787,168 (GRCm39) missense probably damaging 1.00
R5919:Dsel UTSW 1 111,787,983 (GRCm39) missense probably benign
R6820:Dsel UTSW 1 111,787,547 (GRCm39) missense probably damaging 0.99
R7003:Dsel UTSW 1 111,788,025 (GRCm39) missense probably benign
R7064:Dsel UTSW 1 111,790,577 (GRCm39) start gained probably benign
R7297:Dsel UTSW 1 111,789,506 (GRCm39) missense probably damaging 1.00
R7340:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7341:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7343:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7346:Dsel UTSW 1 111,788,798 (GRCm39) missense probably damaging 1.00
R7347:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7365:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7366:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7367:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7393:Dsel UTSW 1 111,789,303 (GRCm39) missense probably damaging 1.00
R7974:Dsel UTSW 1 111,788,229 (GRCm39) missense probably benign 0.00
R7978:Dsel UTSW 1 111,787,449 (GRCm39) nonsense probably null
R8220:Dsel UTSW 1 111,789,437 (GRCm39) missense probably damaging 1.00
R8434:Dsel UTSW 1 111,789,385 (GRCm39) missense probably damaging 1.00
R8819:Dsel UTSW 1 111,787,994 (GRCm39) missense probably benign 0.11
R8820:Dsel UTSW 1 111,787,994 (GRCm39) missense probably benign 0.11
R8923:Dsel UTSW 1 111,788,284 (GRCm39) missense possibly damaging 0.85
R9014:Dsel UTSW 1 111,788,509 (GRCm39) nonsense probably null
R9196:Dsel UTSW 1 111,787,863 (GRCm39) missense probably benign 0.01
R9384:Dsel UTSW 1 111,787,863 (GRCm39) nonsense probably null
R9427:Dsel UTSW 1 111,787,425 (GRCm39) missense probably damaging 0.99
X0057:Dsel UTSW 1 111,786,940 (GRCm39) missense probably benign
Z1177:Dsel UTSW 1 111,789,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAATGGCTTGTACGAGAC -3'
(R):5'- TTTGAATAAGCTGAATGTCACCTGG -3'

Sequencing Primer
(F):5'- CAAATGGCTTGTACGAGACTTTTG -3'
(R):5'- ACCTGGATTTCACAGCCTATGAGG -3'
Posted On 2021-04-30