Incidental Mutation 'R8688:Dsel'
ID 668220
Institutional Source Beutler Lab
Gene Symbol Dsel
Ensembl Gene ENSMUSG00000038702
Gene Name dermatan sulfate epimerase-like
Synonyms 9330132E09Rik, DS-epi2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R8688 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 111858702-111864918 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 111862738 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 22 (C22*)
Ref Sequence ENSEMBL: ENSMUSP00000043570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035462]
AlphaFold Q0VBN2
Predicted Effect probably null
Transcript: ENSMUST00000035462
AA Change: C22*
SMART Domains Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: C22*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 817 N/A INTRINSIC
Pfam:Sulfotransfer_1 847 1201 2.1e-12 PFAM
Pfam:Sulfotransfer_3 848 1143 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,373 T256I probably damaging Het
2700097O09Rik C T 12: 55,057,351 G161D probably damaging Het
4932438A13Rik T A 3: 37,035,917 Y745N Het
Acvr1 G A 2: 58,462,949 A333V probably damaging Het
Adamtsl1 A C 4: 86,248,026 S209R Het
Akr1c18 T C 13: 4,137,195 K207E possibly damaging Het
Anapc1 T G 2: 128,685,828 Q70P probably benign Het
Arhgef33 A G 17: 80,373,186 E585G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
Baz1b T G 5: 135,242,489 S1309A probably benign Het
Bdp1 T C 13: 100,103,799 R14G probably damaging Het
Ccdc150 A C 1: 54,367,973 Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,380,273 F74S probably damaging Het
CK137956 C T 4: 127,950,946 E335K possibly damaging Het
Cyp2c66 A T 19: 39,163,440 I200F probably benign Het
Dmbt1 T A 7: 131,058,254 W412R unknown Het
Ep400 A G 5: 110,720,819 M949T unknown Het
Gcc1 A T 6: 28,418,740 Y531* probably null Het
Gm10277 T C 11: 77,785,579 R189G unknown Het
Gm17078 T A 14: 51,611,230 R17* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grip1 A G 10: 119,999,904 I502V probably benign Het
H2-M9 A T 17: 36,642,142 V91D probably damaging Het
Hcls1 T C 16: 36,961,459 L310P probably benign Het
Hsd17b11 T A 5: 104,021,718 I8F probably benign Het
Ildr2 A T 1: 166,269,533 D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Josd2 T C 7: 44,471,216 W126R probably damaging Het
Ltbp2 T A 12: 84,803,804 D912V probably benign Het
Mdc1 A G 17: 35,850,491 I765M probably benign Het
Mroh1 A G 15: 76,428,350 E579G probably benign Het
Nmur2 T C 11: 56,040,828 N19S probably damaging Het
Obscn T C 11: 59,056,083 Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 C T 2: 111,420,613 V113I probably benign Het
Olfr916 T A 9: 38,657,751 I214L probably benign Het
Orm1 G A 4: 63,346,341 V167M probably damaging Het
Phf14 A G 6: 11,990,035 N688D probably damaging Het
Phlpp2 A G 8: 109,904,380 K219E probably damaging Het
Prdm2 T C 4: 143,111,740 T1683A probably benign Het
Ptprh T A 7: 4,551,023 Q815L probably benign Het
Rag1 A T 2: 101,642,623 Y725N probably damaging Het
Rp1 T A 1: 4,346,405 I1495F probably benign Het
Scn3a A G 2: 65,525,703 V229A possibly damaging Het
Siglech A G 7: 55,768,614 D110G probably benign Het
St8sia2 A T 7: 73,943,344 D321E probably damaging Het
Stxbp3 A G 3: 108,802,109 probably benign Het
Tbccd1 A T 16: 22,822,458 S390T possibly damaging Het
Tg T A 15: 66,694,953 probably benign Het
Trio T A 15: 27,748,238 N2443Y possibly damaging Het
Ube2s C T 7: 4,810,578 M62I probably benign Het
Ugt2b37 T C 5: 87,242,381 D402G possibly damaging Het
Vmn2r80 A G 10: 79,168,235 N94S probably damaging Het
Wapl T A 14: 34,692,592 S470R possibly damaging Het
Xrra1 A G 7: 99,906,545 E373G probably damaging Het
Zfp335 A G 2: 164,892,193 Y1329H probably damaging Het
Zfp689 C A 7: 127,444,912 C182F probably benign Het
Zfp933 T A 4: 147,826,792 S116C probably benign Het
Other mutations in Dsel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dsel APN 1 111860061 nonsense probably null
IGL01562:Dsel APN 1 111860319 missense probably benign
IGL01591:Dsel APN 1 111859695 missense probably benign 0.08
IGL01822:Dsel APN 1 111861896 missense probably damaging 1.00
IGL02289:Dsel APN 1 111860102 nonsense probably null
IGL02557:Dsel APN 1 111862570 missense probably damaging 1.00
IGL02805:Dsel APN 1 111862316 missense probably damaging 1.00
IGL02864:Dsel APN 1 111859214 missense probably damaging 1.00
IGL02887:Dsel APN 1 111860732 missense possibly damaging 0.90
IGL03092:Dsel APN 1 111860063 missense probably damaging 1.00
IGL03117:Dsel APN 1 111859178 utr 3 prime probably benign
IGL03182:Dsel APN 1 111860138 missense probably damaging 0.99
rudolph UTSW 1 111859817 missense probably damaging 0.99
R0196:Dsel UTSW 1 111861603 missense possibly damaging 0.86
R0465:Dsel UTSW 1 111862262 missense probably benign 0.00
R0725:Dsel UTSW 1 111859952 missense possibly damaging 0.79
R1024:Dsel UTSW 1 111860673 missense probably damaging 1.00
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1654:Dsel UTSW 1 111862512 missense probably damaging 1.00
R1728:Dsel UTSW 1 111859457 missense probably benign
R1728:Dsel UTSW 1 111859994 missense probably benign
R1729:Dsel UTSW 1 111859457 missense probably benign
R1729:Dsel UTSW 1 111859994 missense probably benign
R1730:Dsel UTSW 1 111859457 missense probably benign
R1730:Dsel UTSW 1 111859994 missense probably benign
R1735:Dsel UTSW 1 111860915 missense probably damaging 1.00
R1739:Dsel UTSW 1 111859457 missense probably benign
R1739:Dsel UTSW 1 111859994 missense probably benign
R1762:Dsel UTSW 1 111859457 missense probably benign
R1762:Dsel UTSW 1 111859994 missense probably benign
R1783:Dsel UTSW 1 111859457 missense probably benign
R1783:Dsel UTSW 1 111859994 missense probably benign
R1785:Dsel UTSW 1 111859457 missense probably benign
R1785:Dsel UTSW 1 111859994 missense probably benign
R2049:Dsel UTSW 1 111859457 missense probably benign
R2080:Dsel UTSW 1 111859962 missense probably benign
R2141:Dsel UTSW 1 111859457 missense probably benign
R2142:Dsel UTSW 1 111859457 missense probably benign
R2150:Dsel UTSW 1 111860257 missense probably benign 0.04
R4324:Dsel UTSW 1 111861393 missense probably damaging 1.00
R5378:Dsel UTSW 1 111862821 start gained probably benign
R5881:Dsel UTSW 1 111859438 missense probably damaging 1.00
R5919:Dsel UTSW 1 111860253 missense probably benign
R6820:Dsel UTSW 1 111859817 missense probably damaging 0.99
R7003:Dsel UTSW 1 111860295 missense probably benign
R7064:Dsel UTSW 1 111862847 start gained probably benign
R7297:Dsel UTSW 1 111861776 missense probably damaging 1.00
R7340:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7341:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7343:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7346:Dsel UTSW 1 111861068 missense probably damaging 1.00
R7347:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7365:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7366:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7367:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7393:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7974:Dsel UTSW 1 111860499 missense probably benign 0.00
R7978:Dsel UTSW 1 111859719 nonsense probably null
R8220:Dsel UTSW 1 111861707 missense probably damaging 1.00
R8434:Dsel UTSW 1 111861655 missense probably damaging 1.00
R8819:Dsel UTSW 1 111860264 missense probably benign 0.11
R8820:Dsel UTSW 1 111860264 missense probably benign 0.11
R8923:Dsel UTSW 1 111860554 missense possibly damaging 0.85
R9014:Dsel UTSW 1 111860779 nonsense probably null
R9196:Dsel UTSW 1 111860133 missense probably benign 0.01
R9384:Dsel UTSW 1 111860133 nonsense probably null
R9427:Dsel UTSW 1 111859695 missense probably damaging 0.99
X0057:Dsel UTSW 1 111859210 missense probably benign
Z1177:Dsel UTSW 1 111861716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAATGGCTTGTACGAGAC -3'
(R):5'- TTTGAATAAGCTGAATGTCACCTGG -3'

Sequencing Primer
(F):5'- CAAATGGCTTGTACGAGACTTTTG -3'
(R):5'- ACCTGGATTTCACAGCCTATGAGG -3'
Posted On 2021-04-30