Incidental Mutation 'R8688:Anapc1'
ID 668227
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms 2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8688 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 128610104-128687391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 128685828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 70 (Q70P)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110332] [ENSMUST00000110333]
AlphaFold P53995
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: Q70P

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: Q70P

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110332
AA Change: Q70P

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000110333
AA Change: Q70P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: Q70P

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,373 T256I probably damaging Het
2700097O09Rik C T 12: 55,057,351 G161D probably damaging Het
4932438A13Rik T A 3: 37,035,917 Y745N Het
Acvr1 G A 2: 58,462,949 A333V probably damaging Het
Adamtsl1 A C 4: 86,248,026 S209R Het
Akr1c18 T C 13: 4,137,195 K207E possibly damaging Het
Arhgef33 A G 17: 80,373,186 E585G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
Baz1b T G 5: 135,242,489 S1309A probably benign Het
Bdp1 T C 13: 100,103,799 R14G probably damaging Het
Ccdc150 A C 1: 54,367,973 Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,380,273 F74S probably damaging Het
CK137956 C T 4: 127,950,946 E335K possibly damaging Het
Cyp2c66 A T 19: 39,163,440 I200F probably benign Het
Dmbt1 T A 7: 131,058,254 W412R unknown Het
Dsel A T 1: 111,862,738 C22* probably null Het
Ep400 A G 5: 110,720,819 M949T unknown Het
Gcc1 A T 6: 28,418,740 Y531* probably null Het
Gm10277 T C 11: 77,785,579 R189G unknown Het
Gm17078 T A 14: 51,611,230 R17* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grip1 A G 10: 119,999,904 I502V probably benign Het
H2-M9 A T 17: 36,642,142 V91D probably damaging Het
Hcls1 T C 16: 36,961,459 L310P probably benign Het
Hsd17b11 T A 5: 104,021,718 I8F probably benign Het
Ildr2 A T 1: 166,269,533 D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Josd2 T C 7: 44,471,216 W126R probably damaging Het
Ltbp2 T A 12: 84,803,804 D912V probably benign Het
Mdc1 A G 17: 35,850,491 I765M probably benign Het
Mroh1 A G 15: 76,428,350 E579G probably benign Het
Nmur2 T C 11: 56,040,828 N19S probably damaging Het
Obscn T C 11: 59,056,083 Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 C T 2: 111,420,613 V113I probably benign Het
Olfr916 T A 9: 38,657,751 I214L probably benign Het
Orm1 G A 4: 63,346,341 V167M probably damaging Het
Phf14 A G 6: 11,990,035 N688D probably damaging Het
Phlpp2 A G 8: 109,904,380 K219E probably damaging Het
Prdm2 T C 4: 143,111,740 T1683A probably benign Het
Ptprh T A 7: 4,551,023 Q815L probably benign Het
Rag1 A T 2: 101,642,623 Y725N probably damaging Het
Rp1 T A 1: 4,346,405 I1495F probably benign Het
Scn3a A G 2: 65,525,703 V229A possibly damaging Het
Siglech A G 7: 55,768,614 D110G probably benign Het
St8sia2 A T 7: 73,943,344 D321E probably damaging Het
Stxbp3 A G 3: 108,802,109 probably benign Het
Tbccd1 A T 16: 22,822,458 S390T possibly damaging Het
Tg T A 15: 66,694,953 probably benign Het
Trio T A 15: 27,748,238 N2443Y possibly damaging Het
Ube2s C T 7: 4,810,578 M62I probably benign Het
Ugt2b37 T C 5: 87,242,381 D402G possibly damaging Het
Vmn2r80 A G 10: 79,168,235 N94S probably damaging Het
Wapl T A 14: 34,692,592 S470R possibly damaging Het
Xrra1 A G 7: 99,906,545 E373G probably damaging Het
Zfp335 A G 2: 164,892,193 Y1329H probably damaging Het
Zfp689 C A 7: 127,444,912 C182F probably benign Het
Zfp933 T A 4: 147,826,792 S116C probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128664032 missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128641402 missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128634708 missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128622506 missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128623502 missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128622500 missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128617722 missense probably benign 0.08
R9415:Anapc1 UTSW 2 128634678 missense probably benign
R9436:Anapc1 UTSW 2 128676125 missense probably benign
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAAGTTACACAGCATGCCTATG -3'
(R):5'- TGGAACCCATGTCGAACTTC -3'

Sequencing Primer
(F):5'- TGTAGGCAGCACCATATTTCAGC -3'
(R):5'- CCATGTCGAACTTCTCTGAAGAAAGG -3'
Posted On 2021-04-30