Incidental Mutation 'R8688:Zfp335'
ID668228
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8688 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164892193 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1329 (Y1329H)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect probably damaging
Transcript: ENSMUST00000041361
AA Change: Y1329H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: Y1329H

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Meta Mutation Damage Score 0.4717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,373 T256I probably damaging Het
2700097O09Rik C T 12: 55,057,351 G161D probably damaging Het
4932438A13Rik T A 3: 37,035,917 Y745N Het
Acvr1 G A 2: 58,462,949 A333V probably damaging Het
Adamtsl1 A C 4: 86,248,026 S209R Het
Akr1c18 T C 13: 4,137,195 K207E possibly damaging Het
Anapc1 T G 2: 128,685,828 Q70P probably benign Het
Arhgef33 A G 17: 80,373,186 E585G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
Baz1b T G 5: 135,242,489 S1309A probably benign Het
Bdp1 T C 13: 100,103,799 R14G probably damaging Het
Ccdc150 A C 1: 54,367,973 Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,380,273 F74S probably damaging Het
CK137956 C T 4: 127,950,946 E335K possibly damaging Het
Cyp2c66 A T 19: 39,163,440 I200F probably benign Het
Dmbt1 T A 7: 131,058,254 W412R unknown Het
Dsel A T 1: 111,862,738 C22* probably null Het
Ep400 A G 5: 110,720,819 M949T unknown Het
Gcc1 A T 6: 28,418,740 Y531* probably null Het
Gm10277 T C 11: 77,785,579 R189G unknown Het
Gm17078 T A 14: 51,611,230 R17* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grip1 A G 10: 119,999,904 I502V probably benign Het
H2-M9 A T 17: 36,642,142 V91D probably damaging Het
Hcls1 T C 16: 36,961,459 L310P probably benign Het
Hsd17b11 T A 5: 104,021,718 I8F probably benign Het
Ildr2 A T 1: 166,269,533 D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Josd2 T C 7: 44,471,216 W126R probably damaging Het
Ltbp2 T A 12: 84,803,804 D912V probably benign Het
Mdc1 A G 17: 35,850,491 I765M probably benign Het
Mroh1 A G 15: 76,428,350 E579G probably benign Het
Nmur2 T C 11: 56,040,828 N19S probably damaging Het
Obscn T C 11: 59,056,083 Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 C T 2: 111,420,613 V113I probably benign Het
Olfr916 T A 9: 38,657,751 I214L probably benign Het
Orm1 G A 4: 63,346,341 V167M probably damaging Het
Phf14 A G 6: 11,990,035 N688D probably damaging Het
Phlpp2 A G 8: 109,904,380 K219E probably damaging Het
Prdm2 T C 4: 143,111,740 T1683A probably benign Het
Ptprh T A 7: 4,551,023 Q815L probably benign Het
Rag1 A T 2: 101,642,623 Y725N probably damaging Het
Rp1 T A 1: 4,346,405 I1495F probably benign Het
Scn3a A G 2: 65,525,703 V229A possibly damaging Het
Siglech A G 7: 55,768,614 D110G probably benign Het
St8sia2 A T 7: 73,943,344 D321E probably damaging Het
Stxbp3 A G 3: 108,802,109 probably benign Het
Tbccd1 A T 16: 22,822,458 S390T possibly damaging Het
Tg T A 15: 66,694,953 probably benign Het
Trio T A 15: 27,748,238 N2443Y possibly damaging Het
Ube2s C T 7: 4,810,578 M62I probably benign Het
Ugt2b37 T C 5: 87,242,381 D402G possibly damaging Het
Vmn2r80 A G 10: 79,168,235 N94S probably damaging Het
Wapl T A 14: 34,692,592 S470R possibly damaging Het
Xrra1 A G 7: 99,906,545 E373G probably damaging Het
Zfp689 C A 7: 127,444,912 C182F probably benign Het
Zfp933 T A 4: 147,826,792 S116C probably benign Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
R7174:Zfp335 UTSW 2 164902503 missense probably damaging 1.00
R7185:Zfp335 UTSW 2 164893244 critical splice donor site probably null
R7296:Zfp335 UTSW 2 164900132 missense probably damaging 0.99
R7322:Zfp335 UTSW 2 164910821 start codon destroyed probably null 0.90
R7504:Zfp335 UTSW 2 164909418 missense probably benign 0.27
R7560:Zfp335 UTSW 2 164895992 missense probably damaging 1.00
R7637:Zfp335 UTSW 2 164892539 critical splice donor site probably null
R8064:Zfp335 UTSW 2 164907700 missense probably damaging 1.00
R8208:Zfp335 UTSW 2 164893616 critical splice acceptor site probably null
R8228:Zfp335 UTSW 2 164904898 missense probably damaging 1.00
R8271:Zfp335 UTSW 2 164898053 missense probably damaging 0.98
R8803:Zfp335 UTSW 2 164909370 missense probably benign 0.14
RF031:Zfp335 UTSW 2 164907463 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAATTTCTCTCCCAAAGCCTGC -3'
(R):5'- ACTCCGCTGTCACAGGTATG -3'

Sequencing Primer
(F):5'- GCACCCAGCATGTCCTG -3'
(R):5'- TATGGACCGGATACTGCCAG -3'
Posted On2021-04-30