Incidental Mutation 'R8688:Xrra1'
ID668251
Institutional Source Beutler Lab
Gene Symbol Xrra1
Ensembl Gene ENSMUSG00000035211
Gene NameX-ray radiation resistance associated 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8688 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location99859116-99917822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99906545 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 373 (E373G)
Ref Sequence ENSEMBL: ENSMUSP00000035929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036155] [ENSMUST00000207855]
Predicted Effect probably damaging
Transcript: ENSMUST00000036155
AA Change: E373G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035929
Gene: ENSMUSG00000035211
AA Change: E373G

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Blast:LRR 144 168 4e-6 BLAST
LRR 191 214 2.02e-1 SMART
LRR 232 253 1.67e2 SMART
LRR 257 278 6.41e1 SMART
LRR 371 398 4.09e1 SMART
low complexity region 748 756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207855
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,373 T256I probably damaging Het
2700097O09Rik C T 12: 55,057,351 G161D probably damaging Het
4932438A13Rik T A 3: 37,035,917 Y745N Het
Acvr1 G A 2: 58,462,949 A333V probably damaging Het
Adamtsl1 A C 4: 86,248,026 S209R Het
Akr1c18 T C 13: 4,137,195 K207E possibly damaging Het
Anapc1 T G 2: 128,685,828 Q70P probably benign Het
Arhgef33 A G 17: 80,373,186 E585G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
Baz1b T G 5: 135,242,489 S1309A probably benign Het
Bdp1 T C 13: 100,103,799 R14G probably damaging Het
Ccdc150 A C 1: 54,367,973 Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,380,273 F74S probably damaging Het
CK137956 C T 4: 127,950,946 E335K possibly damaging Het
Cyp2c66 A T 19: 39,163,440 I200F probably benign Het
Dmbt1 T A 7: 131,058,254 W412R unknown Het
Dsel A T 1: 111,862,738 C22* probably null Het
Ep400 A G 5: 110,720,819 M949T unknown Het
Gcc1 A T 6: 28,418,740 Y531* probably null Het
Gm10277 T C 11: 77,785,579 R189G unknown Het
Gm17078 T A 14: 51,611,230 R17* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grip1 A G 10: 119,999,904 I502V probably benign Het
H2-M9 A T 17: 36,642,142 V91D probably damaging Het
Hcls1 T C 16: 36,961,459 L310P probably benign Het
Hsd17b11 T A 5: 104,021,718 I8F probably benign Het
Ildr2 A T 1: 166,269,533 D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Josd2 T C 7: 44,471,216 W126R probably damaging Het
Ltbp2 T A 12: 84,803,804 D912V probably benign Het
Mdc1 A G 17: 35,850,491 I765M probably benign Het
Mroh1 A G 15: 76,428,350 E579G probably benign Het
Nmur2 T C 11: 56,040,828 N19S probably damaging Het
Obscn T C 11: 59,056,083 Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1286 C T 2: 111,420,613 V113I probably benign Het
Olfr916 T A 9: 38,657,751 I214L probably benign Het
Orm1 G A 4: 63,346,341 V167M probably damaging Het
Phf14 A G 6: 11,990,035 N688D probably damaging Het
Phlpp2 A G 8: 109,904,380 K219E probably damaging Het
Prdm2 T C 4: 143,111,740 T1683A probably benign Het
Ptprh T A 7: 4,551,023 Q815L probably benign Het
Rag1 A T 2: 101,642,623 Y725N probably damaging Het
Rp1 T A 1: 4,346,405 I1495F probably benign Het
Scn3a A G 2: 65,525,703 V229A possibly damaging Het
Siglech A G 7: 55,768,614 D110G probably benign Het
St8sia2 A T 7: 73,943,344 D321E probably damaging Het
Stxbp3 A G 3: 108,802,109 probably benign Het
Tbccd1 A T 16: 22,822,458 S390T possibly damaging Het
Tg T A 15: 66,694,953 probably benign Het
Trio T A 15: 27,748,238 N2443Y possibly damaging Het
Ube2s C T 7: 4,810,578 M62I probably benign Het
Ugt2b37 T C 5: 87,242,381 D402G possibly damaging Het
Vmn2r80 A G 10: 79,168,235 N94S probably damaging Het
Wapl T A 14: 34,692,592 S470R possibly damaging Het
Zfp335 A G 2: 164,892,193 Y1329H probably damaging Het
Zfp689 C A 7: 127,444,912 C182F probably benign Het
Zfp933 T A 4: 147,826,792 S116C probably benign Het
Other mutations in Xrra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Xrra1 APN 7 99875194 missense possibly damaging 0.76
IGL01938:Xrra1 APN 7 99879469 critical splice donor site probably null
IGL02064:Xrra1 APN 7 99914204 missense probably damaging 1.00
IGL02286:Xrra1 APN 7 99914227 missense possibly damaging 0.62
IGL02415:Xrra1 APN 7 99915943 missense probably benign
R0332:Xrra1 UTSW 7 99876242 missense probably damaging 1.00
R0465:Xrra1 UTSW 7 99879371 missense probably benign 0.00
R0533:Xrra1 UTSW 7 99875145 splice site probably null
R0601:Xrra1 UTSW 7 99910968 missense possibly damaging 0.95
R1539:Xrra1 UTSW 7 99871357 missense probably damaging 1.00
R1672:Xrra1 UTSW 7 99898440 missense probably benign 0.00
R1687:Xrra1 UTSW 7 99876244 missense probably damaging 1.00
R1962:Xrra1 UTSW 7 99911020 missense probably damaging 1.00
R2504:Xrra1 UTSW 7 99897596 missense probably damaging 1.00
R4765:Xrra1 UTSW 7 99906568 missense probably benign 0.19
R4967:Xrra1 UTSW 7 99906523 missense probably damaging 0.99
R5213:Xrra1 UTSW 7 99898483 missense possibly damaging 0.47
R5663:Xrra1 UTSW 7 99886043 missense probably damaging 1.00
R5986:Xrra1 UTSW 7 99876255 missense probably benign 0.40
R6256:Xrra1 UTSW 7 99914464 missense probably damaging 0.99
R6269:Xrra1 UTSW 7 99917472 missense probably damaging 1.00
R7234:Xrra1 UTSW 7 99914249 missense possibly damaging 0.49
R7316:Xrra1 UTSW 7 99876216 critical splice acceptor site probably null
R7655:Xrra1 UTSW 7 99910982 missense probably benign 0.10
R7656:Xrra1 UTSW 7 99910982 missense probably benign 0.10
R8788:Xrra1 UTSW 7 99906554 missense probably benign 0.02
X0017:Xrra1 UTSW 7 99916100 missense probably damaging 1.00
X0021:Xrra1 UTSW 7 99898486 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAGGTCTCTTTGGCCACATTC -3'
(R):5'- AAGTGACAACCTTGGCCAC -3'

Sequencing Primer
(F):5'- TGGCCACATTCTCTACAGAGG -3'
(R):5'- TGACAACCTTGGCCACCTTGAG -3'
Posted On2021-04-30