Incidental Mutation 'R8688:Dmbt1'
ID 668253
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin
MMRRC Submission 068543-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.239) question?
Stock # R8688 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 130633787-130723357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130659984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 412 (W412R)
Ref Sequence ENSEMBL: ENSMUSP00000146685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: W401R
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: W401R

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: W412R
Predicted Effect probably damaging
Transcript: ENSMUST00000213064
AA Change: W516R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 144,982,183 (GRCm39) T256I probably damaging Het
2700097O09Rik C T 12: 55,104,136 (GRCm39) G161D probably damaging Het
Acvr1 G A 2: 58,352,961 (GRCm39) A333V probably damaging Het
Adamtsl1 A C 4: 86,166,263 (GRCm39) S209R Het
Akr1c18 T C 13: 4,187,194 (GRCm39) K207E possibly damaging Het
Anapc1 T G 2: 128,527,748 (GRCm39) Q70P probably benign Het
Arhgef33 A G 17: 80,680,615 (GRCm39) E585G probably damaging Het
Baz1b T G 5: 135,271,343 (GRCm39) S1309A probably benign Het
Bdp1 T C 13: 100,240,307 (GRCm39) R14G probably damaging Het
Bltp1 T A 3: 37,090,066 (GRCm39) Y745N Het
Ccdc150 A C 1: 54,407,132 (GRCm39) Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,298,510 (GRCm39) F74S probably damaging Het
CK137956 C T 4: 127,844,739 (GRCm39) E335K possibly damaging Het
Cyp2c66 A T 19: 39,151,884 (GRCm39) I200F probably benign Het
Dsel A T 1: 111,790,468 (GRCm39) C22* probably null Het
Ep400 A G 5: 110,868,685 (GRCm39) M949T unknown Het
Gcc1 A T 6: 28,418,739 (GRCm39) Y531* probably null Het
Gm10277 T C 11: 77,676,405 (GRCm39) R189G unknown Het
Gm17078 T A 14: 51,848,687 (GRCm39) R17* probably null Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Grip1 A G 10: 119,835,809 (GRCm39) I502V probably benign Het
H2-M9 A T 17: 36,953,034 (GRCm39) V91D probably damaging Het
Hcls1 T C 16: 36,781,821 (GRCm39) L310P probably benign Het
Hsd17b11 T A 5: 104,169,584 (GRCm39) I8F probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Ildr2 A T 1: 166,097,102 (GRCm39) D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,608 (GRCm39) probably benign Het
Josd2 T C 7: 44,120,640 (GRCm39) W126R probably damaging Het
Ltbp2 T A 12: 84,850,578 (GRCm39) D912V probably benign Het
Mdc1 A G 17: 36,161,383 (GRCm39) I765M probably benign Het
Mroh1 A G 15: 76,312,550 (GRCm39) E579G probably benign Het
Nmur2 T C 11: 55,931,654 (GRCm39) N19S probably damaging Het
Obscn T C 11: 58,946,909 (GRCm39) Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or4k40 C T 2: 111,250,958 (GRCm39) V113I probably benign Het
Or8b51 T A 9: 38,569,047 (GRCm39) I214L probably benign Het
Orm1 G A 4: 63,264,578 (GRCm39) V167M probably damaging Het
Phf14 A G 6: 11,990,034 (GRCm39) N688D probably damaging Het
Phlpp2 A G 8: 110,631,012 (GRCm39) K219E probably damaging Het
Prdm2 T C 4: 142,838,310 (GRCm39) T1683A probably benign Het
Ptprh T A 7: 4,554,022 (GRCm39) Q815L probably benign Het
Rag1 A T 2: 101,472,968 (GRCm39) Y725N probably damaging Het
Rp1 T A 1: 4,416,628 (GRCm39) I1495F probably benign Het
Scn3a A G 2: 65,356,047 (GRCm39) V229A possibly damaging Het
Siglech A G 7: 55,418,362 (GRCm39) D110G probably benign Het
St8sia2 A T 7: 73,593,092 (GRCm39) D321E probably damaging Het
Stxbp3 A G 3: 108,709,425 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,641,208 (GRCm39) S390T possibly damaging Het
Tg T A 15: 66,566,802 (GRCm39) probably benign Het
Trio T A 15: 27,748,324 (GRCm39) N2443Y possibly damaging Het
Ube2s C T 7: 4,813,577 (GRCm39) M62I probably benign Het
Ugt2b37 T C 5: 87,390,240 (GRCm39) D402G possibly damaging Het
Vmn2r80 A G 10: 79,004,069 (GRCm39) N94S probably damaging Het
Wapl T A 14: 34,414,549 (GRCm39) S470R possibly damaging Het
Xrra1 A G 7: 99,555,752 (GRCm39) E373G probably damaging Het
Zfp335 A G 2: 164,734,113 (GRCm39) Y1329H probably damaging Het
Zfp689 C A 7: 127,044,084 (GRCm39) C182F probably benign Het
Zfp933 T A 4: 147,911,249 (GRCm39) S116C probably benign Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 130,681,270 (GRCm39) intron probably benign
IGL00161:Dmbt1 APN 7 130,711,357 (GRCm39) missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 130,701,020 (GRCm39) missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 130,684,230 (GRCm39) missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 130,699,337 (GRCm39) missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 130,659,888 (GRCm39) missense probably benign 0.26
IGL01072:Dmbt1 APN 7 130,687,098 (GRCm39) splice site probably benign
IGL01317:Dmbt1 APN 7 130,642,921 (GRCm39) missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 130,690,497 (GRCm39) missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 130,705,409 (GRCm39) missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 130,718,457 (GRCm39) missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 130,682,915 (GRCm39) missense probably benign 0.14
IGL01890:Dmbt1 APN 7 130,676,149 (GRCm39) intron probably benign
IGL02160:Dmbt1 APN 7 130,684,418 (GRCm39) missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 130,694,986 (GRCm39) splice site probably benign
IGL02197:Dmbt1 APN 7 130,687,152 (GRCm39) splice site probably benign
IGL02332:Dmbt1 APN 7 130,668,343 (GRCm39) intron probably benign
IGL02427:Dmbt1 APN 7 130,689,815 (GRCm39) splice site probably null
IGL02726:Dmbt1 APN 7 130,676,140 (GRCm39) intron probably benign
IGL02967:Dmbt1 APN 7 130,672,919 (GRCm39) missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 130,684,409 (GRCm39) missense probably benign 0.05
IGL03089:Dmbt1 APN 7 130,712,778 (GRCm39) missense probably damaging 0.99
cavity UTSW 7 130,713,965 (GRCm39) missense unknown
lacunar UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
BB015:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
H8562:Dmbt1 UTSW 7 130,713,805 (GRCm39) nonsense probably null
K3955:Dmbt1 UTSW 7 130,721,293 (GRCm39) missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 130,708,123 (GRCm39) missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 130,697,779 (GRCm39) splice site probably benign
R0427:Dmbt1 UTSW 7 130,642,632 (GRCm39) nonsense probably null
R0478:Dmbt1 UTSW 7 130,642,917 (GRCm39) missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 130,699,403 (GRCm39) splice site probably null
R0538:Dmbt1 UTSW 7 130,651,631 (GRCm39) splice site probably benign
R0626:Dmbt1 UTSW 7 130,703,811 (GRCm39) missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 130,699,383 (GRCm39) missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 130,694,847 (GRCm39) missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 130,676,254 (GRCm39) critical splice donor site probably null
R1413:Dmbt1 UTSW 7 130,651,944 (GRCm39) missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 130,646,217 (GRCm39) splice site probably benign
R1463:Dmbt1 UTSW 7 130,711,366 (GRCm39) critical splice donor site probably null
R1509:Dmbt1 UTSW 7 130,676,061 (GRCm39) intron probably benign
R1990:Dmbt1 UTSW 7 130,660,018 (GRCm39) missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 130,708,089 (GRCm39) missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 130,700,863 (GRCm39) missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 130,651,748 (GRCm39) missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 130,703,762 (GRCm39) missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 130,699,305 (GRCm39) missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 130,648,292 (GRCm39) missense probably benign 0.03
R2256:Dmbt1 UTSW 7 130,692,224 (GRCm39) missense probably benign 0.01
R2391:Dmbt1 UTSW 7 130,708,198 (GRCm39) missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 130,696,464 (GRCm39) nonsense probably null
R3014:Dmbt1 UTSW 7 130,633,827 (GRCm39) intron probably benign
R3155:Dmbt1 UTSW 7 130,651,887 (GRCm39) nonsense probably null
R3176:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3276:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3442:Dmbt1 UTSW 7 130,707,979 (GRCm39) missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 130,713,819 (GRCm39) missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 130,675,932 (GRCm39) intron probably benign
R4396:Dmbt1 UTSW 7 130,718,361 (GRCm39) missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 130,642,664 (GRCm39) missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 130,651,742 (GRCm39) missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 130,696,472 (GRCm39) missense probably benign 0.01
R5156:Dmbt1 UTSW 7 130,699,400 (GRCm39) critical splice donor site probably null
R5225:Dmbt1 UTSW 7 130,696,465 (GRCm39) missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 130,684,349 (GRCm39) missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 130,642,751 (GRCm39) missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 130,721,240 (GRCm39) missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 130,642,723 (GRCm39) missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 130,665,133 (GRCm39) intron probably benign
R5526:Dmbt1 UTSW 7 130,642,920 (GRCm39) missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 130,701,030 (GRCm39) nonsense probably null
R5566:Dmbt1 UTSW 7 130,708,003 (GRCm39) missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 130,655,797 (GRCm39) missense probably benign 0.17
R6154:Dmbt1 UTSW 7 130,711,370 (GRCm39) splice site probably null
R6188:Dmbt1 UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 130,705,308 (GRCm39) missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 130,718,370 (GRCm39) missense probably benign 0.01
R6603:Dmbt1 UTSW 7 130,648,240 (GRCm39) splice site probably null
R6719:Dmbt1 UTSW 7 130,721,332 (GRCm39) missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 130,648,291 (GRCm39) missense probably benign 0.16
R7148:Dmbt1 UTSW 7 130,668,464 (GRCm39) nonsense probably null
R7191:Dmbt1 UTSW 7 130,646,250 (GRCm39) missense unknown
R7269:Dmbt1 UTSW 7 130,668,351 (GRCm39) missense unknown
R7288:Dmbt1 UTSW 7 130,685,519 (GRCm39) nonsense probably null
R7296:Dmbt1 UTSW 7 130,713,861 (GRCm39) missense unknown
R7349:Dmbt1 UTSW 7 130,642,854 (GRCm39) missense unknown
R7386:Dmbt1 UTSW 7 130,713,965 (GRCm39) missense unknown
R7428:Dmbt1 UTSW 7 130,710,192 (GRCm39) missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 130,681,241 (GRCm39) critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 130,668,192 (GRCm39) missense unknown
R7513:Dmbt1 UTSW 7 130,692,242 (GRCm39) missense unknown
R7553:Dmbt1 UTSW 7 130,706,597 (GRCm39) missense unknown
R7567:Dmbt1 UTSW 7 130,663,093 (GRCm39) splice site probably null
R7584:Dmbt1 UTSW 7 130,690,481 (GRCm39) nonsense probably null
R7736:Dmbt1 UTSW 7 130,718,625 (GRCm39) missense unknown
R7758:Dmbt1 UTSW 7 130,722,926 (GRCm39) missense unknown
R7928:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
R8080:Dmbt1 UTSW 7 130,690,500 (GRCm39) missense unknown
R8098:Dmbt1 UTSW 7 130,710,188 (GRCm39) nonsense probably null
R8125:Dmbt1 UTSW 7 130,700,953 (GRCm39) missense unknown
R8177:Dmbt1 UTSW 7 130,708,162 (GRCm39) missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8366:Dmbt1 UTSW 7 130,668,330 (GRCm39) missense unknown
R8378:Dmbt1 UTSW 7 130,708,195 (GRCm39) missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8400:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8445:Dmbt1 UTSW 7 130,692,110 (GRCm39) missense unknown
R8450:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8511:Dmbt1 UTSW 7 130,703,742 (GRCm39) missense unknown
R8850:Dmbt1 UTSW 7 130,692,134 (GRCm39) missense unknown
R8852:Dmbt1 UTSW 7 130,642,853 (GRCm39) missense unknown
R8871:Dmbt1 UTSW 7 130,718,597 (GRCm39) missense unknown
R8943:Dmbt1 UTSW 7 130,721,372 (GRCm39) missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 130,639,611 (GRCm39) missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 130,713,798 (GRCm39) missense unknown
R9020:Dmbt1 UTSW 7 130,712,787 (GRCm39) missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 130,718,418 (GRCm39) missense unknown
R9230:Dmbt1 UTSW 7 130,639,642 (GRCm39) missense probably benign 0.01
R9304:Dmbt1 UTSW 7 130,700,855 (GRCm39) missense unknown
R9377:Dmbt1 UTSW 7 130,694,832 (GRCm39) missense unknown
R9428:Dmbt1 UTSW 7 130,668,208 (GRCm39) missense unknown
R9474:Dmbt1 UTSW 7 130,675,987 (GRCm39) missense unknown
R9573:Dmbt1 UTSW 7 130,657,910 (GRCm39) critical splice donor site probably null
R9675:Dmbt1 UTSW 7 130,712,652 (GRCm39) missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 130,660,015 (GRCm39) missense unknown
R9781:Dmbt1 UTSW 7 130,639,599 (GRCm39) missense probably benign 0.00
X0024:Dmbt1 UTSW 7 130,713,977 (GRCm39) nonsense probably null
X0062:Dmbt1 UTSW 7 130,696,581 (GRCm39) missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 130,690,542 (GRCm39) missense unknown
Z1177:Dmbt1 UTSW 7 130,684,215 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAGATCCTTTACCAGGGTTC -3'
(R):5'- TGGCTAAGAGGGGCATTGTC -3'

Sequencing Primer
(F):5'- AGGGTTCCTGGGGCACTG -3'
(R):5'- GGCATTGTCTGGGATATTCACCAAAC -3'
Posted On 2021-04-30