Incidental Mutation 'R8688:Phlpp2'
ID 668254
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission 068543-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R8688 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 110595174-110671303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110631012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 219 (K219E)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect probably damaging
Transcript: ENSMUST00000034175
AA Change: K184E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: K184E

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179721
AA Change: K219E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: K219E

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 144,982,183 (GRCm39) T256I probably damaging Het
2700097O09Rik C T 12: 55,104,136 (GRCm39) G161D probably damaging Het
Acvr1 G A 2: 58,352,961 (GRCm39) A333V probably damaging Het
Adamtsl1 A C 4: 86,166,263 (GRCm39) S209R Het
Akr1c18 T C 13: 4,187,194 (GRCm39) K207E possibly damaging Het
Anapc1 T G 2: 128,527,748 (GRCm39) Q70P probably benign Het
Arhgef33 A G 17: 80,680,615 (GRCm39) E585G probably damaging Het
Baz1b T G 5: 135,271,343 (GRCm39) S1309A probably benign Het
Bdp1 T C 13: 100,240,307 (GRCm39) R14G probably damaging Het
Bltp1 T A 3: 37,090,066 (GRCm39) Y745N Het
Ccdc150 A C 1: 54,407,132 (GRCm39) Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,298,510 (GRCm39) F74S probably damaging Het
CK137956 C T 4: 127,844,739 (GRCm39) E335K possibly damaging Het
Cyp2c66 A T 19: 39,151,884 (GRCm39) I200F probably benign Het
Dmbt1 T A 7: 130,659,984 (GRCm39) W412R unknown Het
Dsel A T 1: 111,790,468 (GRCm39) C22* probably null Het
Ep400 A G 5: 110,868,685 (GRCm39) M949T unknown Het
Gcc1 A T 6: 28,418,739 (GRCm39) Y531* probably null Het
Gm10277 T C 11: 77,676,405 (GRCm39) R189G unknown Het
Gm17078 T A 14: 51,848,687 (GRCm39) R17* probably null Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Grip1 A G 10: 119,835,809 (GRCm39) I502V probably benign Het
H2-M9 A T 17: 36,953,034 (GRCm39) V91D probably damaging Het
Hcls1 T C 16: 36,781,821 (GRCm39) L310P probably benign Het
Hsd17b11 T A 5: 104,169,584 (GRCm39) I8F probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Ildr2 A T 1: 166,097,102 (GRCm39) D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,608 (GRCm39) probably benign Het
Josd2 T C 7: 44,120,640 (GRCm39) W126R probably damaging Het
Ltbp2 T A 12: 84,850,578 (GRCm39) D912V probably benign Het
Mdc1 A G 17: 36,161,383 (GRCm39) I765M probably benign Het
Mroh1 A G 15: 76,312,550 (GRCm39) E579G probably benign Het
Nmur2 T C 11: 55,931,654 (GRCm39) N19S probably damaging Het
Obscn T C 11: 58,946,909 (GRCm39) Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or4k40 C T 2: 111,250,958 (GRCm39) V113I probably benign Het
Or8b51 T A 9: 38,569,047 (GRCm39) I214L probably benign Het
Orm1 G A 4: 63,264,578 (GRCm39) V167M probably damaging Het
Phf14 A G 6: 11,990,034 (GRCm39) N688D probably damaging Het
Prdm2 T C 4: 142,838,310 (GRCm39) T1683A probably benign Het
Ptprh T A 7: 4,554,022 (GRCm39) Q815L probably benign Het
Rag1 A T 2: 101,472,968 (GRCm39) Y725N probably damaging Het
Rp1 T A 1: 4,416,628 (GRCm39) I1495F probably benign Het
Scn3a A G 2: 65,356,047 (GRCm39) V229A possibly damaging Het
Siglech A G 7: 55,418,362 (GRCm39) D110G probably benign Het
St8sia2 A T 7: 73,593,092 (GRCm39) D321E probably damaging Het
Stxbp3 A G 3: 108,709,425 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,641,208 (GRCm39) S390T possibly damaging Het
Tg T A 15: 66,566,802 (GRCm39) probably benign Het
Trio T A 15: 27,748,324 (GRCm39) N2443Y possibly damaging Het
Ube2s C T 7: 4,813,577 (GRCm39) M62I probably benign Het
Ugt2b37 T C 5: 87,390,240 (GRCm39) D402G possibly damaging Het
Vmn2r80 A G 10: 79,004,069 (GRCm39) N94S probably damaging Het
Wapl T A 14: 34,414,549 (GRCm39) S470R possibly damaging Het
Xrra1 A G 7: 99,555,752 (GRCm39) E373G probably damaging Het
Zfp335 A G 2: 164,734,113 (GRCm39) Y1329H probably damaging Het
Zfp689 C A 7: 127,044,084 (GRCm39) C182F probably benign Het
Zfp933 T A 4: 147,911,249 (GRCm39) S116C probably benign Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 110,652,422 (GRCm39) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 110,663,729 (GRCm39) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 110,660,697 (GRCm39) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 110,666,491 (GRCm39) missense probably benign
IGL02105:Phlpp2 APN 8 110,631,040 (GRCm39) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 110,646,731 (GRCm39) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 110,666,505 (GRCm39) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 110,640,250 (GRCm39) missense probably benign
IGL03356:Phlpp2 APN 8 110,662,249 (GRCm39) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 110,667,467 (GRCm39) missense probably benign 0.44
R0142:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 110,666,567 (GRCm39) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 110,655,095 (GRCm39) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 110,622,138 (GRCm39) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 110,603,603 (GRCm39) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 110,659,843 (GRCm39) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 110,622,219 (GRCm39) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 110,603,662 (GRCm39) nonsense probably null
R1417:Phlpp2 UTSW 8 110,667,313 (GRCm39) nonsense probably null
R1602:Phlpp2 UTSW 8 110,660,655 (GRCm39) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 110,660,587 (GRCm39) splice site probably benign
R1815:Phlpp2 UTSW 8 110,666,855 (GRCm39) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 110,634,232 (GRCm39) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 110,666,634 (GRCm39) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 110,634,245 (GRCm39) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 110,603,515 (GRCm39) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 110,667,452 (GRCm39) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 110,667,052 (GRCm39) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 110,603,642 (GRCm39) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 110,666,714 (GRCm39) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 110,640,251 (GRCm39) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 110,652,461 (GRCm39) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 110,660,667 (GRCm39) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 110,630,976 (GRCm39) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 110,655,205 (GRCm39) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 110,661,317 (GRCm39) missense probably benign
R6470:Phlpp2 UTSW 8 110,663,826 (GRCm39) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 110,655,197 (GRCm39) missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 110,603,486 (GRCm39) missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 110,666,585 (GRCm39) missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 110,666,820 (GRCm39) missense probably benign
R7312:Phlpp2 UTSW 8 110,666,785 (GRCm39) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 110,655,278 (GRCm39) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 110,652,474 (GRCm39) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 110,622,189 (GRCm39) missense probably benign 0.00
R8174:Phlpp2 UTSW 8 110,595,321 (GRCm39) missense unknown
R8242:Phlpp2 UTSW 8 110,666,834 (GRCm39) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 110,640,202 (GRCm39) missense probably benign
R8843:Phlpp2 UTSW 8 110,652,431 (GRCm39) missense probably benign 0.18
R9154:Phlpp2 UTSW 8 110,666,590 (GRCm39) missense possibly damaging 0.82
R9556:Phlpp2 UTSW 8 110,666,758 (GRCm39) missense probably benign
R9737:Phlpp2 UTSW 8 110,663,714 (GRCm39) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 110,662,178 (GRCm39) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 110,660,655 (GRCm39) nonsense probably null
X0018:Phlpp2 UTSW 8 110,639,001 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGATGTTGGCACACAC -3'
(R):5'- TTTAAACAGGGGCTCTGAAGATC -3'

Sequencing Primer
(F):5'- GGATGTTGGCACACACATTTTC -3'
(R):5'- CTCTGAAGATCAAATGGAGGCCC -3'
Posted On 2021-04-30