Incidental Mutation 'R8688:Mdc1'
ID 668273
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Name mediator of DNA damage checkpoint 1
Synonyms NFBD1
MMRRC Submission 068543-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R8688 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 36152407-36170562 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36161383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 765 (I765M)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: I765M

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: I765M

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 144,982,183 (GRCm39) T256I probably damaging Het
2700097O09Rik C T 12: 55,104,136 (GRCm39) G161D probably damaging Het
Acvr1 G A 2: 58,352,961 (GRCm39) A333V probably damaging Het
Adamtsl1 A C 4: 86,166,263 (GRCm39) S209R Het
Akr1c18 T C 13: 4,187,194 (GRCm39) K207E possibly damaging Het
Anapc1 T G 2: 128,527,748 (GRCm39) Q70P probably benign Het
Arhgef33 A G 17: 80,680,615 (GRCm39) E585G probably damaging Het
Baz1b T G 5: 135,271,343 (GRCm39) S1309A probably benign Het
Bdp1 T C 13: 100,240,307 (GRCm39) R14G probably damaging Het
Bltp1 T A 3: 37,090,066 (GRCm39) Y745N Het
Ccdc150 A C 1: 54,407,132 (GRCm39) Q1058H probably damaging Het
Cdk5rap2 A G 4: 70,298,510 (GRCm39) F74S probably damaging Het
CK137956 C T 4: 127,844,739 (GRCm39) E335K possibly damaging Het
Cyp2c66 A T 19: 39,151,884 (GRCm39) I200F probably benign Het
Dmbt1 T A 7: 130,659,984 (GRCm39) W412R unknown Het
Dsel A T 1: 111,790,468 (GRCm39) C22* probably null Het
Ep400 A G 5: 110,868,685 (GRCm39) M949T unknown Het
Gcc1 A T 6: 28,418,739 (GRCm39) Y531* probably null Het
Gm10277 T C 11: 77,676,405 (GRCm39) R189G unknown Het
Gm17078 T A 14: 51,848,687 (GRCm39) R17* probably null Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Grip1 A G 10: 119,835,809 (GRCm39) I502V probably benign Het
H2-M9 A T 17: 36,953,034 (GRCm39) V91D probably damaging Het
Hcls1 T C 16: 36,781,821 (GRCm39) L310P probably benign Het
Hsd17b11 T A 5: 104,169,584 (GRCm39) I8F probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Ildr2 A T 1: 166,097,102 (GRCm39) D107V probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,608 (GRCm39) probably benign Het
Josd2 T C 7: 44,120,640 (GRCm39) W126R probably damaging Het
Ltbp2 T A 12: 84,850,578 (GRCm39) D912V probably benign Het
Mroh1 A G 15: 76,312,550 (GRCm39) E579G probably benign Het
Nmur2 T C 11: 55,931,654 (GRCm39) N19S probably damaging Het
Obscn T C 11: 58,946,909 (GRCm39) Y4075C probably damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or4k40 C T 2: 111,250,958 (GRCm39) V113I probably benign Het
Or8b51 T A 9: 38,569,047 (GRCm39) I214L probably benign Het
Orm1 G A 4: 63,264,578 (GRCm39) V167M probably damaging Het
Phf14 A G 6: 11,990,034 (GRCm39) N688D probably damaging Het
Phlpp2 A G 8: 110,631,012 (GRCm39) K219E probably damaging Het
Prdm2 T C 4: 142,838,310 (GRCm39) T1683A probably benign Het
Ptprh T A 7: 4,554,022 (GRCm39) Q815L probably benign Het
Rag1 A T 2: 101,472,968 (GRCm39) Y725N probably damaging Het
Rp1 T A 1: 4,416,628 (GRCm39) I1495F probably benign Het
Scn3a A G 2: 65,356,047 (GRCm39) V229A possibly damaging Het
Siglech A G 7: 55,418,362 (GRCm39) D110G probably benign Het
St8sia2 A T 7: 73,593,092 (GRCm39) D321E probably damaging Het
Stxbp3 A G 3: 108,709,425 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,641,208 (GRCm39) S390T possibly damaging Het
Tg T A 15: 66,566,802 (GRCm39) probably benign Het
Trio T A 15: 27,748,324 (GRCm39) N2443Y possibly damaging Het
Ube2s C T 7: 4,813,577 (GRCm39) M62I probably benign Het
Ugt2b37 T C 5: 87,390,240 (GRCm39) D402G possibly damaging Het
Vmn2r80 A G 10: 79,004,069 (GRCm39) N94S probably damaging Het
Wapl T A 14: 34,414,549 (GRCm39) S470R possibly damaging Het
Xrra1 A G 7: 99,555,752 (GRCm39) E373G probably damaging Het
Zfp335 A G 2: 164,734,113 (GRCm39) Y1329H probably damaging Het
Zfp689 C A 7: 127,044,084 (GRCm39) C182F probably benign Het
Zfp933 T A 4: 147,911,249 (GRCm39) S116C probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 36,158,912 (GRCm39) missense probably benign 0.04
IGL01662:Mdc1 APN 17 36,163,397 (GRCm39) missense probably benign 0.00
IGL01931:Mdc1 APN 17 36,159,123 (GRCm39) missense probably benign 0.00
IGL02542:Mdc1 APN 17 36,164,048 (GRCm39) missense probably damaging 0.96
IGL02823:Mdc1 APN 17 36,163,815 (GRCm39) missense probably damaging 0.99
IGL03411:Mdc1 APN 17 36,164,018 (GRCm39) missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 36,157,083 (GRCm39) missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 36,155,361 (GRCm39) missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 36,159,925 (GRCm39) missense probably benign 0.00
R0129:Mdc1 UTSW 17 36,165,337 (GRCm39) missense probably benign 0.04
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0132:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1597:Mdc1 UTSW 17 36,156,758 (GRCm39) missense probably damaging 1.00
R1721:Mdc1 UTSW 17 36,158,718 (GRCm39) missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1912:Mdc1 UTSW 17 36,161,703 (GRCm39) missense probably benign 0.19
R1912:Mdc1 UTSW 17 36,155,430 (GRCm39) missense probably benign 0.00
R1977:Mdc1 UTSW 17 36,161,822 (GRCm39) missense probably benign 0.01
R2121:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2122:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2357:Mdc1 UTSW 17 36,158,337 (GRCm39) missense probably benign 0.00
R2842:Mdc1 UTSW 17 36,159,686 (GRCm39) missense probably benign 0.01
R2851:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2852:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2964:Mdc1 UTSW 17 36,164,529 (GRCm39) missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 36,158,785 (GRCm39) unclassified probably benign
R3752:Mdc1 UTSW 17 36,156,821 (GRCm39) missense probably damaging 1.00
R4234:Mdc1 UTSW 17 36,159,716 (GRCm39) missense probably benign 0.00
R4641:Mdc1 UTSW 17 36,168,361 (GRCm39) missense probably benign 0.09
R4706:Mdc1 UTSW 17 36,163,671 (GRCm39) missense probably damaging 0.99
R4809:Mdc1 UTSW 17 36,159,993 (GRCm39) critical splice donor site probably null
R4833:Mdc1 UTSW 17 36,161,286 (GRCm39) missense probably benign 0.20
R5032:Mdc1 UTSW 17 36,161,481 (GRCm39) missense probably benign 0.00
R5047:Mdc1 UTSW 17 36,158,736 (GRCm39) missense probably benign 0.00
R5086:Mdc1 UTSW 17 36,159,522 (GRCm39) missense probably benign 0.00
R5172:Mdc1 UTSW 17 36,163,982 (GRCm39) missense probably benign 0.00
R5254:Mdc1 UTSW 17 36,158,814 (GRCm39) missense probably benign 0.00
R5473:Mdc1 UTSW 17 36,158,952 (GRCm39) missense probably benign 0.01
R5550:Mdc1 UTSW 17 36,156,776 (GRCm39) missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 36,159,438 (GRCm39) missense probably benign 0.00
R5888:Mdc1 UTSW 17 36,158,712 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,168,464 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,159,525 (GRCm39) missense probably benign 0.04
R6219:Mdc1 UTSW 17 36,161,566 (GRCm39) missense probably benign 0.10
R7053:Mdc1 UTSW 17 36,157,218 (GRCm39) missense probably benign 0.00
R7073:Mdc1 UTSW 17 36,164,960 (GRCm39) missense probably benign 0.18
R7077:Mdc1 UTSW 17 36,156,839 (GRCm39) missense probably damaging 0.97
R7424:Mdc1 UTSW 17 36,164,201 (GRCm39) missense probably benign 0.04
R7443:Mdc1 UTSW 17 36,161,712 (GRCm39) missense probably damaging 0.98
R7467:Mdc1 UTSW 17 36,155,448 (GRCm39) missense probably benign 0.29
R7549:Mdc1 UTSW 17 36,159,749 (GRCm39) missense probably null 0.04
R7655:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7656:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7960:Mdc1 UTSW 17 36,161,570 (GRCm39) nonsense probably null
R8350:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8450:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8726:Mdc1 UTSW 17 36,158,475 (GRCm39) missense probably benign 0.04
R8919:Mdc1 UTSW 17 36,158,843 (GRCm39) missense probably benign 0.00
R8961:Mdc1 UTSW 17 36,159,407 (GRCm39) missense probably benign 0.10
R9324:Mdc1 UTSW 17 36,164,258 (GRCm39) missense probably benign 0.10
R9363:Mdc1 UTSW 17 36,162,019 (GRCm39) missense probably benign 0.00
R9385:Mdc1 UTSW 17 36,161,396 (GRCm39) missense probably benign 0.00
RF025:Mdc1 UTSW 17 36,165,299 (GRCm39) critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 36,161,829 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGAAGTCTTGGCTACACAG -3'
(R):5'- AAATCAGCTGGCTCCCATTC -3'

Sequencing Primer
(F):5'- GCCGTTCTGTCTAAGAGAACAGTC -3'
(R):5'- CTGACTGTCTCTAGCTAACACC -3'
Posted On 2021-04-30