Incidental Mutation 'R8690:Fam185a'
ID668296
Institutional Source Beutler Lab
Gene Symbol Fam185a
Ensembl Gene ENSMUSG00000047221
Gene Namefamily with sequence similarity 185, member A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8690 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21424958-21482124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21433768 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 199 (H199Q)
Ref Sequence ENSEMBL: ENSMUSP00000058333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056045]
Predicted Effect probably benign
Transcript: ENSMUST00000056045
AA Change: H199Q

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058333
Gene: ENSMUSG00000047221
AA Change: H199Q

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,061,172 T81S possibly damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Acbd5 T A 2: 23,089,698 S210T probably benign Het
Adam10 T A 9: 70,748,223 F324L probably damaging Het
Ak6 A G 13: 100,655,349 N100S possibly damaging Het
Angptl3 G T 4: 99,037,522 V362L probably benign Het
Ano9 C A 7: 141,104,307 W514L probably benign Het
Asb8 T C 15: 98,136,227 Y149C probably damaging Het
Bcl6b C A 11: 70,226,621 A392S probably damaging Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cad T A 5: 31,075,156 I1855N possibly damaging Het
Calm5 G A 13: 3,854,277 G4R probably damaging Het
Carm1 T C 9: 21,569,512 V94A probably damaging Het
Ccnl1 A T 3: 65,947,744 S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 I168N probably benign Het
Ces2g C T 8: 104,966,973 R429C probably benign Het
Chd3 T C 11: 69,355,822 probably benign Het
Cmtr2 T A 8: 110,222,345 M429K probably benign Het
Cnga1 T G 5: 72,604,492 I560L probably benign Het
Col6a5 A G 9: 105,882,597 Y1975H probably damaging Het
Copb1 T C 7: 114,250,228 I47V probably benign Het
Ddx41 A G 13: 55,533,126 L324P probably damaging Het
Dhx57 A G 17: 80,270,365 probably benign Het
Dlgap2 A T 8: 14,743,430 I475F probably benign Het
Dock2 T A 11: 34,727,460 K110* probably null Het
Dpp7 T C 2: 25,355,633 D147G probably damaging Het
Dync2h1 G T 9: 7,075,824 D3014E probably damaging Het
Efcab5 A T 11: 77,103,289 F1291I probably damaging Het
Endov T A 11: 119,491,910 V61D probably benign Het
Etv3 C A 3: 87,536,479 P457T possibly damaging Het
Fat3 T A 9: 15,967,101 E3361D probably benign Het
Fbn1 T C 2: 125,344,095 probably benign Het
Gm17079 A T 14: 51,695,330 W37R Het
Gpr68 T C 12: 100,879,033 H84R probably benign Het
Gramd1b A T 9: 40,304,378 S725R probably damaging Het
Greb1 T A 12: 16,696,547 T1241S probably benign Het
Hcn4 T C 9: 58,843,910 M273T probably benign Het
Hdlbp A G 1: 93,413,918 V973A probably damaging Het
Ighv8-11 A T 12: 115,567,544 probably benign Het
Itpkb A T 1: 180,421,781 Q907L probably benign Het
Lmo7 T A 14: 101,931,208 N1634K unknown Het
Lrrk1 C A 7: 66,302,729 L486F probably benign Het
Mdfic G A 6: 15,799,654 C260Y probably damaging Het
Mdh2 T C 5: 135,786,028 I140T probably benign Het
Myo9a T C 9: 59,875,374 V1775A probably benign Het
Olfr342 T C 2: 36,528,195 V261A probably benign Het
Olfr557 C A 7: 102,698,821 D194E probably damaging Het
Olfr665 T C 7: 104,881,555 Y283H probably damaging Het
P2rx2 C T 5: 110,342,514 V112I probably damaging Het
Psme4 T A 11: 30,837,319 V1038E probably benign Het
Rab25 T A 3: 88,545,081 R73S probably damaging Het
Rab8a TA TAA 8: 72,171,286 probably null Het
Rnf213 T C 11: 119,418,129 Y729H Het
Rnf213 A G 11: 119,441,212 T2417A Het
Rnft2 C A 5: 118,228,870 A268S probably benign Het
Samhd1 T C 2: 157,129,874 D116G probably benign Het
Sema6d T A 2: 124,665,017 V915E probably benign Het
Srcin1 C A 11: 97,523,542 R1045L probably damaging Het
St18 T A 1: 6,802,564 N174K probably benign Het
Stac3 G A 10: 127,503,625 C130Y probably damaging Het
Stum G C 1: 180,483,175 P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 E526K possibly damaging Het
Tiam1 A G 16: 89,898,012 S186P probably damaging Het
Tiparp G C 3: 65,553,542 V651L probably benign Het
Tmem19 C T 10: 115,343,860 G244S probably damaging Het
Trip11 A T 12: 101,873,397 V1658D possibly damaging Het
Ttyh3 A C 5: 140,627,189 Y453D probably damaging Het
Ttyh3 G T 5: 140,627,190 S452R probably benign Het
Zbtb4 T C 11: 69,776,792 S308P probably damaging Het
Zfyve1 T C 12: 83,550,907 E672G probably damaging Het
Zswim5 G A 4: 116,984,805 D861N probably damaging Het
Other mutations in Fam185a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Fam185a APN 5 21480342 missense probably damaging 1.00
IGL01980:Fam185a APN 5 21459173 missense probably damaging 1.00
IGL02096:Fam185a APN 5 21425343 missense probably damaging 1.00
IGL02264:Fam185a APN 5 21480394 missense possibly damaging 0.63
IGL02553:Fam185a APN 5 21455831 missense probably damaging 1.00
IGL02553:Fam185a APN 5 21429841 splice site probably benign
IGL03082:Fam185a APN 5 21455838 missense possibly damaging 0.49
famine UTSW 5 21425454 missense probably benign 0.00
R0389:Fam185a UTSW 5 21459285 missense probably damaging 0.99
R1872:Fam185a UTSW 5 21480330 critical splice acceptor site probably null
R1883:Fam185a UTSW 5 21425244 missense possibly damaging 0.85
R3775:Fam185a UTSW 5 21455806 missense probably damaging 1.00
R4190:Fam185a UTSW 5 21425124 unclassified probably benign
R4192:Fam185a UTSW 5 21425124 unclassified probably benign
R4194:Fam185a UTSW 5 21425454 missense probably benign 0.00
R4704:Fam185a UTSW 5 21480473 utr 3 prime probably benign
R4724:Fam185a UTSW 5 21455787 missense probably damaging 1.00
R4837:Fam185a UTSW 5 21480377 missense probably benign 0.00
R6225:Fam185a UTSW 5 21425556 missense probably damaging 0.99
R6438:Fam185a UTSW 5 21458972 splice site probably null
R6475:Fam185a UTSW 5 21425283 missense probably benign 0.01
R7512:Fam185a UTSW 5 21447358 critical splice donor site probably null
R8400:Fam185a UTSW 5 21438816 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTGTGACTGTGACAAAGTTCGAG -3'
(R):5'- AGTCAGACTTATCAAGGGTTTAGTG -3'

Sequencing Primer
(F):5'- TCAATACTTTGCTTAAATCCCTGG -3'
(R):5'- TCAAGGGTTTAGTGAATCTAATGAAC -3'
Posted On2021-04-30