Incidental Mutation 'R8690:Fam185a'
ID 668296
Institutional Source Beutler Lab
Gene Symbol Fam185a
Ensembl Gene ENSMUSG00000047221
Gene Name family with sequence similarity 185, member A
Synonyms
MMRRC Submission 068544-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8690 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 21629956-21687122 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21638766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 199 (H199Q)
Ref Sequence ENSEMBL: ENSMUSP00000058333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056045]
AlphaFold Q7TPD2
Predicted Effect probably benign
Transcript: ENSMUST00000056045
AA Change: H199Q

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058333
Gene: ENSMUSG00000047221
AA Change: H199Q

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,107,957 (GRCm39) T81S possibly damaging Het
Ablim2 C T 5: 36,030,518 (GRCm39) A581V possibly damaging Het
Acbd5 T A 2: 22,979,710 (GRCm39) S210T probably benign Het
Adam10 T A 9: 70,655,505 (GRCm39) F324L probably damaging Het
Ak6 A G 13: 100,791,857 (GRCm39) N100S possibly damaging Het
Angptl3 G T 4: 98,925,759 (GRCm39) V362L probably benign Het
Ano9 C A 7: 140,684,220 (GRCm39) W514L probably benign Het
Asb8 T C 15: 98,034,108 (GRCm39) Y149C probably damaging Het
Bcl6b C A 11: 70,117,447 (GRCm39) A392S probably damaging Het
Cad T A 5: 31,232,500 (GRCm39) I1855N possibly damaging Het
Calm5 G A 13: 3,904,277 (GRCm39) G4R probably damaging Het
Carm1 T C 9: 21,480,808 (GRCm39) V94A probably damaging Het
Ccnl1 A T 3: 65,855,165 (GRCm39) S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 (GRCm39) I168N probably benign Het
Ces2g C T 8: 105,693,605 (GRCm39) R429C probably benign Het
Chd3 T C 11: 69,246,648 (GRCm39) probably benign Het
Cmtr2 T A 8: 110,948,977 (GRCm39) M429K probably benign Het
Cnga1 T G 5: 72,761,835 (GRCm39) I560L probably benign Het
Col6a5 A G 9: 105,759,796 (GRCm39) Y1975H probably damaging Het
Copb1 T C 7: 113,849,463 (GRCm39) I47V probably benign Het
Crbn G A 6: 106,777,010 (GRCm39) probably benign Het
Ddx41 A G 13: 55,680,939 (GRCm39) L324P probably damaging Het
Dhx57 A G 17: 80,577,794 (GRCm39) probably benign Het
Dlgap2 A T 8: 14,793,430 (GRCm39) I475F probably benign Het
Dock2 T A 11: 34,618,287 (GRCm39) K110* probably null Het
Dpp7 T C 2: 25,245,645 (GRCm39) D147G probably damaging Het
Dync2h1 G T 9: 7,075,824 (GRCm39) D3014E probably damaging Het
Efcab5 A T 11: 76,994,115 (GRCm39) F1291I probably damaging Het
Endov T A 11: 119,382,736 (GRCm39) V61D probably benign Het
Etv3 C A 3: 87,443,786 (GRCm39) P457T possibly damaging Het
Fat3 T A 9: 15,878,397 (GRCm39) E3361D probably benign Het
Fbn1 T C 2: 125,186,015 (GRCm39) probably benign Het
Gm17079 A T 14: 51,932,787 (GRCm39) W37R Het
Gpr68 T C 12: 100,845,292 (GRCm39) H84R probably benign Het
Gramd1b A T 9: 40,215,674 (GRCm39) S725R probably damaging Het
Greb1 T A 12: 16,746,548 (GRCm39) T1241S probably benign Het
Hcn4 T C 9: 58,751,193 (GRCm39) M273T probably benign Het
Hdlbp A G 1: 93,341,640 (GRCm39) V973A probably damaging Het
Ighv8-11 A T 12: 115,531,164 (GRCm39) probably benign Het
Itpkb A T 1: 180,249,346 (GRCm39) Q907L probably benign Het
Lmo7 T A 14: 102,168,644 (GRCm39) N1634K unknown Het
Lrrk1 C A 7: 65,952,477 (GRCm39) L486F probably benign Het
Mdfic G A 6: 15,799,653 (GRCm39) C260Y probably damaging Het
Mdh2 T C 5: 135,814,882 (GRCm39) I140T probably benign Het
Myo9a T C 9: 59,782,657 (GRCm39) V1775A probably benign Het
Or1j14 T C 2: 36,418,207 (GRCm39) V261A probably benign Het
Or51d1 C A 7: 102,348,028 (GRCm39) D194E probably damaging Het
Or52n3 T C 7: 104,530,762 (GRCm39) Y283H probably damaging Het
P2rx2 C T 5: 110,490,380 (GRCm39) V112I probably damaging Het
Psme4 T A 11: 30,787,319 (GRCm39) V1038E probably benign Het
Rab25 T A 3: 88,452,388 (GRCm39) R73S probably damaging Het
Rab8a TA TAA 8: 72,925,130 (GRCm39) probably null Het
Rnf213 T C 11: 119,308,955 (GRCm39) Y729H Het
Rnf213 A G 11: 119,332,038 (GRCm39) T2417A Het
Rnft2 C A 5: 118,366,935 (GRCm39) A268S probably benign Het
Samhd1 T C 2: 156,971,794 (GRCm39) D116G probably benign Het
Sema6d T A 2: 124,506,937 (GRCm39) V915E probably benign Het
Sp140l2 G A 1: 85,235,170 (GRCm39) H130Y probably benign Het
Srcin1 C A 11: 97,414,368 (GRCm39) R1045L probably damaging Het
St18 T A 1: 6,872,788 (GRCm39) N174K probably benign Het
Stac3 G A 10: 127,339,494 (GRCm39) C130Y probably damaging Het
Stum G C 1: 180,310,740 (GRCm39) P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 (GRCm39) E526K possibly damaging Het
Tiam1 A G 16: 89,694,900 (GRCm39) S186P probably damaging Het
Tiparp G C 3: 65,460,963 (GRCm39) V651L probably benign Het
Tmem19 C T 10: 115,179,765 (GRCm39) G244S probably damaging Het
Trip11 A T 12: 101,839,656 (GRCm39) V1658D possibly damaging Het
Ttyh3 A C 5: 140,612,944 (GRCm39) Y453D probably damaging Het
Ttyh3 G T 5: 140,612,945 (GRCm39) S452R probably benign Het
Ube2h C T 6: 30,262,338 (GRCm39) probably benign Het
Zbtb4 T C 11: 69,667,618 (GRCm39) S308P probably damaging Het
Zfyve1 T C 12: 83,597,681 (GRCm39) E672G probably damaging Het
Zswim5 G A 4: 116,842,002 (GRCm39) D861N probably damaging Het
Other mutations in Fam185a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Fam185a APN 5 21,685,340 (GRCm39) missense probably damaging 1.00
IGL01980:Fam185a APN 5 21,664,171 (GRCm39) missense probably damaging 1.00
IGL02096:Fam185a APN 5 21,630,341 (GRCm39) missense probably damaging 1.00
IGL02264:Fam185a APN 5 21,685,392 (GRCm39) missense possibly damaging 0.63
IGL02553:Fam185a APN 5 21,634,839 (GRCm39) splice site probably benign
IGL02553:Fam185a APN 5 21,660,829 (GRCm39) missense probably damaging 1.00
IGL03082:Fam185a APN 5 21,660,836 (GRCm39) missense possibly damaging 0.49
famine UTSW 5 21,630,452 (GRCm39) missense probably benign 0.00
R0389:Fam185a UTSW 5 21,664,283 (GRCm39) missense probably damaging 0.99
R1872:Fam185a UTSW 5 21,685,328 (GRCm39) critical splice acceptor site probably null
R1883:Fam185a UTSW 5 21,630,242 (GRCm39) missense possibly damaging 0.85
R3775:Fam185a UTSW 5 21,660,804 (GRCm39) missense probably damaging 1.00
R4190:Fam185a UTSW 5 21,630,122 (GRCm39) unclassified probably benign
R4192:Fam185a UTSW 5 21,630,122 (GRCm39) unclassified probably benign
R4194:Fam185a UTSW 5 21,630,452 (GRCm39) missense probably benign 0.00
R4704:Fam185a UTSW 5 21,685,471 (GRCm39) utr 3 prime probably benign
R4724:Fam185a UTSW 5 21,660,785 (GRCm39) missense probably damaging 1.00
R4837:Fam185a UTSW 5 21,685,375 (GRCm39) missense probably benign 0.00
R6225:Fam185a UTSW 5 21,630,554 (GRCm39) missense probably damaging 0.99
R6438:Fam185a UTSW 5 21,663,970 (GRCm39) splice site probably null
R6475:Fam185a UTSW 5 21,630,281 (GRCm39) missense probably benign 0.01
R7512:Fam185a UTSW 5 21,652,356 (GRCm39) critical splice donor site probably null
R8400:Fam185a UTSW 5 21,643,814 (GRCm39) missense probably benign 0.14
R9157:Fam185a UTSW 5 21,660,837 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGACTGTGACAAAGTTCGAG -3'
(R):5'- AGTCAGACTTATCAAGGGTTTAGTG -3'

Sequencing Primer
(F):5'- TCAATACTTTGCTTAAATCCCTGG -3'
(R):5'- TCAAGGGTTTAGTGAATCTAATGAAC -3'
Posted On 2021-04-30