Incidental Mutation 'R8690:Dync2h1'
ID 668315
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Name dynein cytoplasmic 2 heavy chain 1
Synonyms DHC1b, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, 4432416O06Rik, DHC2, D330044F14Rik
MMRRC Submission 068544-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8690 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 6928550-7177619 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 7075824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3014 (D3014E)
Ref Sequence ENSEMBL: ENSMUSP00000046733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048417
AA Change: D3014E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: D3014E

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139671
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140466
AA Change: D3014E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: D3014E

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147193
AA Change: D3014E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: D3014E

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,107,957 (GRCm39) T81S possibly damaging Het
Ablim2 C T 5: 36,030,518 (GRCm39) A581V possibly damaging Het
Acbd5 T A 2: 22,979,710 (GRCm39) S210T probably benign Het
Adam10 T A 9: 70,655,505 (GRCm39) F324L probably damaging Het
Ak6 A G 13: 100,791,857 (GRCm39) N100S possibly damaging Het
Angptl3 G T 4: 98,925,759 (GRCm39) V362L probably benign Het
Ano9 C A 7: 140,684,220 (GRCm39) W514L probably benign Het
Asb8 T C 15: 98,034,108 (GRCm39) Y149C probably damaging Het
Bcl6b C A 11: 70,117,447 (GRCm39) A392S probably damaging Het
Cad T A 5: 31,232,500 (GRCm39) I1855N possibly damaging Het
Calm5 G A 13: 3,904,277 (GRCm39) G4R probably damaging Het
Carm1 T C 9: 21,480,808 (GRCm39) V94A probably damaging Het
Ccnl1 A T 3: 65,855,165 (GRCm39) S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 (GRCm39) I168N probably benign Het
Ces2g C T 8: 105,693,605 (GRCm39) R429C probably benign Het
Chd3 T C 11: 69,246,648 (GRCm39) probably benign Het
Cmtr2 T A 8: 110,948,977 (GRCm39) M429K probably benign Het
Cnga1 T G 5: 72,761,835 (GRCm39) I560L probably benign Het
Col6a5 A G 9: 105,759,796 (GRCm39) Y1975H probably damaging Het
Copb1 T C 7: 113,849,463 (GRCm39) I47V probably benign Het
Crbn G A 6: 106,777,010 (GRCm39) probably benign Het
Ddx41 A G 13: 55,680,939 (GRCm39) L324P probably damaging Het
Dhx57 A G 17: 80,577,794 (GRCm39) probably benign Het
Dlgap2 A T 8: 14,793,430 (GRCm39) I475F probably benign Het
Dock2 T A 11: 34,618,287 (GRCm39) K110* probably null Het
Dpp7 T C 2: 25,245,645 (GRCm39) D147G probably damaging Het
Efcab5 A T 11: 76,994,115 (GRCm39) F1291I probably damaging Het
Endov T A 11: 119,382,736 (GRCm39) V61D probably benign Het
Etv3 C A 3: 87,443,786 (GRCm39) P457T possibly damaging Het
Fam185a T A 5: 21,638,766 (GRCm39) H199Q probably benign Het
Fat3 T A 9: 15,878,397 (GRCm39) E3361D probably benign Het
Fbn1 T C 2: 125,186,015 (GRCm39) probably benign Het
Gm17079 A T 14: 51,932,787 (GRCm39) W37R Het
Gpr68 T C 12: 100,845,292 (GRCm39) H84R probably benign Het
Gramd1b A T 9: 40,215,674 (GRCm39) S725R probably damaging Het
Greb1 T A 12: 16,746,548 (GRCm39) T1241S probably benign Het
Hcn4 T C 9: 58,751,193 (GRCm39) M273T probably benign Het
Hdlbp A G 1: 93,341,640 (GRCm39) V973A probably damaging Het
Ighv8-11 A T 12: 115,531,164 (GRCm39) probably benign Het
Itpkb A T 1: 180,249,346 (GRCm39) Q907L probably benign Het
Lmo7 T A 14: 102,168,644 (GRCm39) N1634K unknown Het
Lrrk1 C A 7: 65,952,477 (GRCm39) L486F probably benign Het
Mdfic G A 6: 15,799,653 (GRCm39) C260Y probably damaging Het
Mdh2 T C 5: 135,814,882 (GRCm39) I140T probably benign Het
Myo9a T C 9: 59,782,657 (GRCm39) V1775A probably benign Het
Or1j14 T C 2: 36,418,207 (GRCm39) V261A probably benign Het
Or51d1 C A 7: 102,348,028 (GRCm39) D194E probably damaging Het
Or52n3 T C 7: 104,530,762 (GRCm39) Y283H probably damaging Het
P2rx2 C T 5: 110,490,380 (GRCm39) V112I probably damaging Het
Psme4 T A 11: 30,787,319 (GRCm39) V1038E probably benign Het
Rab25 T A 3: 88,452,388 (GRCm39) R73S probably damaging Het
Rab8a TA TAA 8: 72,925,130 (GRCm39) probably null Het
Rnf213 T C 11: 119,308,955 (GRCm39) Y729H Het
Rnf213 A G 11: 119,332,038 (GRCm39) T2417A Het
Rnft2 C A 5: 118,366,935 (GRCm39) A268S probably benign Het
Samhd1 T C 2: 156,971,794 (GRCm39) D116G probably benign Het
Sema6d T A 2: 124,506,937 (GRCm39) V915E probably benign Het
Sp140l2 G A 1: 85,235,170 (GRCm39) H130Y probably benign Het
Srcin1 C A 11: 97,414,368 (GRCm39) R1045L probably damaging Het
St18 T A 1: 6,872,788 (GRCm39) N174K probably benign Het
Stac3 G A 10: 127,339,494 (GRCm39) C130Y probably damaging Het
Stum G C 1: 180,310,740 (GRCm39) P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 (GRCm39) E526K possibly damaging Het
Tiam1 A G 16: 89,694,900 (GRCm39) S186P probably damaging Het
Tiparp G C 3: 65,460,963 (GRCm39) V651L probably benign Het
Tmem19 C T 10: 115,179,765 (GRCm39) G244S probably damaging Het
Trip11 A T 12: 101,839,656 (GRCm39) V1658D possibly damaging Het
Ttyh3 A C 5: 140,612,944 (GRCm39) Y453D probably damaging Het
Ttyh3 G T 5: 140,612,945 (GRCm39) S452R probably benign Het
Ube2h C T 6: 30,262,338 (GRCm39) probably benign Het
Zbtb4 T C 11: 69,667,618 (GRCm39) S308P probably damaging Het
Zfyve1 T C 12: 83,597,681 (GRCm39) E672G probably damaging Het
Zswim5 G A 4: 116,842,002 (GRCm39) D861N probably damaging Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7,158,839 (GRCm39) missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7,155,072 (GRCm39) splice site probably benign
IGL00499:Dync2h1 APN 9 7,168,700 (GRCm39) missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7,035,728 (GRCm39) splice site probably benign
IGL00660:Dync2h1 APN 9 7,075,797 (GRCm39) missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7,174,881 (GRCm39) splice site probably benign
IGL01025:Dync2h1 APN 9 7,162,789 (GRCm39) missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7,145,611 (GRCm39) missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7,176,771 (GRCm39) missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7,116,588 (GRCm39) missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7,102,493 (GRCm39) missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7,071,111 (GRCm39) missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7,071,922 (GRCm39) missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7,140,897 (GRCm39) critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7,118,884 (GRCm39) nonsense probably null
IGL01681:Dync2h1 APN 9 7,142,196 (GRCm39) splice site probably null
IGL01685:Dync2h1 APN 9 7,142,297 (GRCm39) missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7,081,077 (GRCm39) missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7,114,922 (GRCm39) missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7,118,822 (GRCm39) unclassified probably benign
IGL01813:Dync2h1 APN 9 7,122,799 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,114,973 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,011,207 (GRCm39) missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7,075,892 (GRCm39) missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7,134,349 (GRCm39) missense probably benign
IGL02140:Dync2h1 APN 9 7,147,791 (GRCm39) missense probably benign
IGL02175:Dync2h1 APN 9 7,111,548 (GRCm39) missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7,125,912 (GRCm39) missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7,122,678 (GRCm39) missense probably benign
IGL02342:Dync2h1 APN 9 7,142,246 (GRCm39) missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7,158,926 (GRCm39) missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7,117,422 (GRCm39) missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7,035,700 (GRCm39) missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6,955,901 (GRCm39) splice site probably benign
IGL02955:Dync2h1 APN 9 7,142,864 (GRCm39) missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7,137,074 (GRCm39) missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6,935,279 (GRCm39) missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7,076,235 (GRCm39) missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7,125,918 (GRCm39) missense probably benign
IGL03233:Dync2h1 APN 9 7,101,525 (GRCm39) missense possibly damaging 0.90
deinonychus UTSW 9 7,159,478 (GRCm39) splice site probably null
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0043:Dync2h1 UTSW 9 7,005,574 (GRCm39) missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7,001,327 (GRCm39) splice site probably benign
R0277:Dync2h1 UTSW 9 7,129,046 (GRCm39) missense probably benign
R0360:Dync2h1 UTSW 9 7,113,182 (GRCm39) missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7,005,487 (GRCm39) splice site probably null
R0389:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0443:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0496:Dync2h1 UTSW 9 7,155,180 (GRCm39) missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7,113,153 (GRCm39) missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7,122,692 (GRCm39) missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7,120,954 (GRCm39) splice site probably null
R0564:Dync2h1 UTSW 9 7,139,432 (GRCm39) missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7,103,680 (GRCm39) missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7,015,497 (GRCm39) missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7,116,642 (GRCm39) critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7,077,979 (GRCm39) missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7,041,734 (GRCm39) splice site probably benign
R0938:Dync2h1 UTSW 9 7,002,658 (GRCm39) missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7,147,731 (GRCm39) missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7,005,488 (GRCm39) critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7,101,193 (GRCm39) splice site probably benign
R1243:Dync2h1 UTSW 9 7,120,882 (GRCm39) missense probably benign
R1295:Dync2h1 UTSW 9 7,075,752 (GRCm39) splice site probably benign
R1304:Dync2h1 UTSW 9 7,102,318 (GRCm39) missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7,125,816 (GRCm39) missense probably benign
R1513:Dync2h1 UTSW 9 7,103,663 (GRCm39) missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7,140,911 (GRCm39) missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7,157,553 (GRCm39) missense probably null 0.02
R1570:Dync2h1 UTSW 9 7,176,926 (GRCm39) missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6,993,942 (GRCm39) missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7,131,891 (GRCm39) missense probably benign
R1766:Dync2h1 UTSW 9 7,015,526 (GRCm39) critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7,128,256 (GRCm39) missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7,081,084 (GRCm39) missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7,049,166 (GRCm39) missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7,001,448 (GRCm39) missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7,001,377 (GRCm39) missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7,129,045 (GRCm39) missense probably benign
R2012:Dync2h1 UTSW 9 7,169,589 (GRCm39) missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7,162,925 (GRCm39) missense probably benign 0.25
R2020:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2024:Dync2h1 UTSW 9 7,129,062 (GRCm39) missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6,967,226 (GRCm39) missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7,160,171 (GRCm39) missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7,162,802 (GRCm39) missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7,148,735 (GRCm39) missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7,175,289 (GRCm39) missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7,011,253 (GRCm39) missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7,124,797 (GRCm39) missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7,037,828 (GRCm39) splice site probably null
R2255:Dync2h1 UTSW 9 6,955,905 (GRCm39) critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7,081,053 (GRCm39) missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7,122,618 (GRCm39) missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7,144,246 (GRCm39) missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7,102,329 (GRCm39) missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7,049,114 (GRCm39) missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7,011,236 (GRCm39) missense probably benign
R3719:Dync2h1 UTSW 9 7,006,882 (GRCm39) splice site probably benign
R3723:Dync2h1 UTSW 9 7,041,658 (GRCm39) missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7,101,525 (GRCm39) missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6,935,293 (GRCm39) missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7,001,482 (GRCm39) missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7,124,825 (GRCm39) missense probably benign
R3950:Dync2h1 UTSW 9 7,112,061 (GRCm39) nonsense probably null
R4004:Dync2h1 UTSW 9 7,117,404 (GRCm39) missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7,131,881 (GRCm39) missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7,134,360 (GRCm39) missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7,077,880 (GRCm39) missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6,983,477 (GRCm39) missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7,085,009 (GRCm39) nonsense probably null
R4596:Dync2h1 UTSW 9 6,992,595 (GRCm39) missense probably benign
R4604:Dync2h1 UTSW 9 7,140,995 (GRCm39) missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7,051,411 (GRCm39) missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7,169,640 (GRCm39) missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7,118,932 (GRCm39) missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7,142,648 (GRCm39) critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7,006,862 (GRCm39) missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7,139,422 (GRCm39) missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7,134,364 (GRCm39) missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7,147,717 (GRCm39) missense probably benign
R4899:Dync2h1 UTSW 9 7,131,921 (GRCm39) nonsense probably null
R4971:Dync2h1 UTSW 9 7,131,949 (GRCm39) missense probably benign
R5040:Dync2h1 UTSW 9 6,992,625 (GRCm39) missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7,085,007 (GRCm39) missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7,116,540 (GRCm39) missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7,155,099 (GRCm39) missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7,129,727 (GRCm39) missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7,176,962 (GRCm39) unclassified probably benign
R5384:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7,120,899 (GRCm39) nonsense probably null
R5402:Dync2h1 UTSW 9 7,114,949 (GRCm39) missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7,144,217 (GRCm39) missense probably benign
R5538:Dync2h1 UTSW 9 7,168,630 (GRCm39) intron probably benign
R5551:Dync2h1 UTSW 9 7,031,718 (GRCm39) missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7,118,885 (GRCm39) missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7,120,909 (GRCm39) missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7,116,638 (GRCm39) missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7,169,689 (GRCm39) missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7,169,528 (GRCm39) missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7,165,762 (GRCm39) missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6,996,905 (GRCm39) missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7,148,717 (GRCm39) missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7,102,309 (GRCm39) critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7,037,801 (GRCm39) missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7,117,466 (GRCm39) nonsense probably null
R5982:Dync2h1 UTSW 9 6,955,986 (GRCm39) missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7,157,646 (GRCm39) missense probably benign
R6125:Dync2h1 UTSW 9 7,168,706 (GRCm39) missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7,165,677 (GRCm39) missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7,135,078 (GRCm39) missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7,084,986 (GRCm39) missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7,165,717 (GRCm39) missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7,165,703 (GRCm39) missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7,168,331 (GRCm39) missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7,159,478 (GRCm39) splice site probably null
R6554:Dync2h1 UTSW 9 7,037,699 (GRCm39) missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7,139,501 (GRCm39) missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7,120,819 (GRCm39) missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7,041,718 (GRCm39) missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7,159,632 (GRCm39) missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7,131,855 (GRCm39) missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7,102,549 (GRCm39) missense probably benign
R6997:Dync2h1 UTSW 9 7,168,743 (GRCm39) missense probably null 0.00
R7084:Dync2h1 UTSW 9 7,113,214 (GRCm39) missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7,075,788 (GRCm39) missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7,075,786 (GRCm39) missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7,050,479 (GRCm39) missense probably benign
R7196:Dync2h1 UTSW 9 7,147,715 (GRCm39) nonsense probably null
R7208:Dync2h1 UTSW 9 7,141,059 (GRCm39) missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7,142,756 (GRCm39) missense probably benign
R7237:Dync2h1 UTSW 9 6,993,966 (GRCm39) missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7,102,405 (GRCm39) missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6,929,590 (GRCm39) missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7,001,454 (GRCm39) missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7,011,247 (GRCm39) missense probably benign
R7351:Dync2h1 UTSW 9 7,167,145 (GRCm39) missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7,159,479 (GRCm39) critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7,157,932 (GRCm39) missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7,041,720 (GRCm39) missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7,132,041 (GRCm39) missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7,124,855 (GRCm39) missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7,135,015 (GRCm39) splice site probably null
R7501:Dync2h1 UTSW 9 7,175,336 (GRCm39) missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7,002,623 (GRCm39) missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7,101,111 (GRCm39) missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7,141,254 (GRCm39) missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7,117,570 (GRCm39) missense probably benign
R7654:Dync2h1 UTSW 9 7,122,664 (GRCm39) missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7,076,232 (GRCm39) missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7,015,490 (GRCm39) missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7,129,719 (GRCm39) missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7,114,914 (GRCm39) missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7,118,953 (GRCm39) missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7,005,566 (GRCm39) missense possibly damaging 0.80
R7952:Dync2h1 UTSW 9 7,129,802 (GRCm39) missense possibly damaging 0.63
R8111:Dync2h1 UTSW 9 7,148,688 (GRCm39) missense probably benign 0.03
R8157:Dync2h1 UTSW 9 7,001,473 (GRCm39) missense possibly damaging 0.47
R8166:Dync2h1 UTSW 9 7,129,089 (GRCm39) nonsense probably null
R8236:Dync2h1 UTSW 9 7,080,363 (GRCm39) intron probably benign
R8326:Dync2h1 UTSW 9 7,147,771 (GRCm39) missense probably benign
R8335:Dync2h1 UTSW 9 7,084,941 (GRCm39) missense probably benign 0.28
R8347:Dync2h1 UTSW 9 7,116,578 (GRCm39) missense possibly damaging 0.81
R8372:Dync2h1 UTSW 9 7,111,514 (GRCm39) missense possibly damaging 0.90
R8421:Dync2h1 UTSW 9 7,102,477 (GRCm39) missense probably damaging 1.00
R8518:Dync2h1 UTSW 9 7,051,452 (GRCm39) missense probably benign 0.04
R8556:Dync2h1 UTSW 9 7,113,198 (GRCm39) missense probably benign 0.32
R8713:Dync2h1 UTSW 9 7,141,008 (GRCm39) nonsense probably null
R8719:Dync2h1 UTSW 9 7,041,641 (GRCm39) missense probably benign 0.05
R8732:Dync2h1 UTSW 9 7,168,326 (GRCm39) missense probably damaging 1.00
R8744:Dync2h1 UTSW 9 7,011,220 (GRCm39) nonsense probably null
R8749:Dync2h1 UTSW 9 7,035,063 (GRCm39) missense probably benign 0.32
R8795:Dync2h1 UTSW 9 7,137,087 (GRCm39) missense probably benign 0.00
R8853:Dync2h1 UTSW 9 7,117,645 (GRCm39) missense possibly damaging 0.94
R8923:Dync2h1 UTSW 9 7,168,515 (GRCm39) missense probably benign
R8969:Dync2h1 UTSW 9 7,130,723 (GRCm39) missense probably damaging 1.00
R8988:Dync2h1 UTSW 9 7,037,727 (GRCm39) missense probably benign 0.00
R8997:Dync2h1 UTSW 9 7,129,003 (GRCm39) missense probably benign
R9025:Dync2h1 UTSW 9 7,139,462 (GRCm39) nonsense probably null
R9036:Dync2h1 UTSW 9 7,051,495 (GRCm39) missense probably damaging 1.00
R9055:Dync2h1 UTSW 9 6,996,641 (GRCm39) intron probably benign
R9165:Dync2h1 UTSW 9 7,114,883 (GRCm39) missense probably damaging 0.99
R9172:Dync2h1 UTSW 9 7,031,771 (GRCm39) missense probably damaging 1.00
R9286:Dync2h1 UTSW 9 6,941,668 (GRCm39) missense probably benign 0.01
R9312:Dync2h1 UTSW 9 7,050,413 (GRCm39) missense probably damaging 1.00
R9335:Dync2h1 UTSW 9 7,112,149 (GRCm39) missense possibly damaging 0.88
R9344:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R9351:Dync2h1 UTSW 9 7,176,911 (GRCm39) missense probably damaging 0.98
R9367:Dync2h1 UTSW 9 7,125,730 (GRCm39) critical splice donor site probably null
R9613:Dync2h1 UTSW 9 7,075,769 (GRCm39) missense probably damaging 0.99
R9650:Dync2h1 UTSW 9 7,174,849 (GRCm39) missense possibly damaging 0.83
R9726:Dync2h1 UTSW 9 7,077,999 (GRCm39) missense possibly damaging 0.94
R9731:Dync2h1 UTSW 9 7,141,166 (GRCm39) missense probably benign
X0009:Dync2h1 UTSW 9 7,117,576 (GRCm39) missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7,168,730 (GRCm39) frame shift probably null
Z1176:Dync2h1 UTSW 9 7,142,361 (GRCm39) missense probably damaging 0.99
Z1177:Dync2h1 UTSW 9 7,102,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCTGCCATGGTAAACATCTC -3'
(R):5'- TGCACATTTGACTAAGTAGCCAG -3'

Sequencing Primer
(F):5'- CTGCCATGGTAAACATCTCTAATAC -3'
(R):5'- GACTAAGTAGCCAGGCTTTTTC -3'
Posted On 2021-04-30