Incidental Mutation 'R8690:Psme4'
ID 668325
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 068544-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8690 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30787319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1038 (V1038E)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably benign
Transcript: ENSMUST00000041231
AA Change: V1038E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: V1038E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Meta Mutation Damage Score 0.0753 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,107,957 (GRCm39) T81S possibly damaging Het
Ablim2 C T 5: 36,030,518 (GRCm39) A581V possibly damaging Het
Acbd5 T A 2: 22,979,710 (GRCm39) S210T probably benign Het
Adam10 T A 9: 70,655,505 (GRCm39) F324L probably damaging Het
Ak6 A G 13: 100,791,857 (GRCm39) N100S possibly damaging Het
Angptl3 G T 4: 98,925,759 (GRCm39) V362L probably benign Het
Ano9 C A 7: 140,684,220 (GRCm39) W514L probably benign Het
Asb8 T C 15: 98,034,108 (GRCm39) Y149C probably damaging Het
Bcl6b C A 11: 70,117,447 (GRCm39) A392S probably damaging Het
Cad T A 5: 31,232,500 (GRCm39) I1855N possibly damaging Het
Calm5 G A 13: 3,904,277 (GRCm39) G4R probably damaging Het
Carm1 T C 9: 21,480,808 (GRCm39) V94A probably damaging Het
Ccnl1 A T 3: 65,855,165 (GRCm39) S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 (GRCm39) I168N probably benign Het
Ces2g C T 8: 105,693,605 (GRCm39) R429C probably benign Het
Chd3 T C 11: 69,246,648 (GRCm39) probably benign Het
Cmtr2 T A 8: 110,948,977 (GRCm39) M429K probably benign Het
Cnga1 T G 5: 72,761,835 (GRCm39) I560L probably benign Het
Col6a5 A G 9: 105,759,796 (GRCm39) Y1975H probably damaging Het
Copb1 T C 7: 113,849,463 (GRCm39) I47V probably benign Het
Crbn G A 6: 106,777,010 (GRCm39) probably benign Het
Ddx41 A G 13: 55,680,939 (GRCm39) L324P probably damaging Het
Dhx57 A G 17: 80,577,794 (GRCm39) probably benign Het
Dlgap2 A T 8: 14,793,430 (GRCm39) I475F probably benign Het
Dock2 T A 11: 34,618,287 (GRCm39) K110* probably null Het
Dpp7 T C 2: 25,245,645 (GRCm39) D147G probably damaging Het
Dync2h1 G T 9: 7,075,824 (GRCm39) D3014E probably damaging Het
Efcab5 A T 11: 76,994,115 (GRCm39) F1291I probably damaging Het
Endov T A 11: 119,382,736 (GRCm39) V61D probably benign Het
Etv3 C A 3: 87,443,786 (GRCm39) P457T possibly damaging Het
Fam185a T A 5: 21,638,766 (GRCm39) H199Q probably benign Het
Fat3 T A 9: 15,878,397 (GRCm39) E3361D probably benign Het
Fbn1 T C 2: 125,186,015 (GRCm39) probably benign Het
Gm17079 A T 14: 51,932,787 (GRCm39) W37R Het
Gpr68 T C 12: 100,845,292 (GRCm39) H84R probably benign Het
Gramd1b A T 9: 40,215,674 (GRCm39) S725R probably damaging Het
Greb1 T A 12: 16,746,548 (GRCm39) T1241S probably benign Het
Hcn4 T C 9: 58,751,193 (GRCm39) M273T probably benign Het
Hdlbp A G 1: 93,341,640 (GRCm39) V973A probably damaging Het
Ighv8-11 A T 12: 115,531,164 (GRCm39) probably benign Het
Itpkb A T 1: 180,249,346 (GRCm39) Q907L probably benign Het
Lmo7 T A 14: 102,168,644 (GRCm39) N1634K unknown Het
Lrrk1 C A 7: 65,952,477 (GRCm39) L486F probably benign Het
Mdfic G A 6: 15,799,653 (GRCm39) C260Y probably damaging Het
Mdh2 T C 5: 135,814,882 (GRCm39) I140T probably benign Het
Myo9a T C 9: 59,782,657 (GRCm39) V1775A probably benign Het
Or1j14 T C 2: 36,418,207 (GRCm39) V261A probably benign Het
Or51d1 C A 7: 102,348,028 (GRCm39) D194E probably damaging Het
Or52n3 T C 7: 104,530,762 (GRCm39) Y283H probably damaging Het
P2rx2 C T 5: 110,490,380 (GRCm39) V112I probably damaging Het
Rab25 T A 3: 88,452,388 (GRCm39) R73S probably damaging Het
Rab8a TA TAA 8: 72,925,130 (GRCm39) probably null Het
Rnf213 T C 11: 119,308,955 (GRCm39) Y729H Het
Rnf213 A G 11: 119,332,038 (GRCm39) T2417A Het
Rnft2 C A 5: 118,366,935 (GRCm39) A268S probably benign Het
Samhd1 T C 2: 156,971,794 (GRCm39) D116G probably benign Het
Sema6d T A 2: 124,506,937 (GRCm39) V915E probably benign Het
Sp140l2 G A 1: 85,235,170 (GRCm39) H130Y probably benign Het
Srcin1 C A 11: 97,414,368 (GRCm39) R1045L probably damaging Het
St18 T A 1: 6,872,788 (GRCm39) N174K probably benign Het
Stac3 G A 10: 127,339,494 (GRCm39) C130Y probably damaging Het
Stum G C 1: 180,310,740 (GRCm39) P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 (GRCm39) E526K possibly damaging Het
Tiam1 A G 16: 89,694,900 (GRCm39) S186P probably damaging Het
Tiparp G C 3: 65,460,963 (GRCm39) V651L probably benign Het
Tmem19 C T 10: 115,179,765 (GRCm39) G244S probably damaging Het
Trip11 A T 12: 101,839,656 (GRCm39) V1658D possibly damaging Het
Ttyh3 A C 5: 140,612,944 (GRCm39) Y453D probably damaging Het
Ttyh3 G T 5: 140,612,945 (GRCm39) S452R probably benign Het
Ube2h C T 6: 30,262,338 (GRCm39) probably benign Het
Zbtb4 T C 11: 69,667,618 (GRCm39) S308P probably damaging Het
Zfyve1 T C 12: 83,597,681 (GRCm39) E672G probably damaging Het
Zswim5 G A 4: 116,842,002 (GRCm39) D861N probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAAAATATTAATGGGTCCACTTGC -3'
(R):5'- GGTTGCTTACTGTAAAATCCAAGC -3'

Sequencing Primer
(F):5'- ATGGGTCCACTTGCTTATACCTCAAG -3'
(R):5'- GCTTACTGTAAAATCCAAGCCAATTG -3'
Posted On 2021-04-30