Incidental Mutation 'R8690:Psme4'
ID 668325
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8690 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30837319 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1038 (V1038E)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably benign
Transcript: ENSMUST00000041231
AA Change: V1038E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: V1038E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Meta Mutation Damage Score 0.0753 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,061,172 T81S possibly damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Acbd5 T A 2: 23,089,698 S210T probably benign Het
Adam10 T A 9: 70,748,223 F324L probably damaging Het
Ak6 A G 13: 100,655,349 N100S possibly damaging Het
Angptl3 G T 4: 99,037,522 V362L probably benign Het
Ano9 C A 7: 141,104,307 W514L probably benign Het
Asb8 T C 15: 98,136,227 Y149C probably damaging Het
Bcl6b C A 11: 70,226,621 A392S probably damaging Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cad T A 5: 31,075,156 I1855N possibly damaging Het
Calm5 G A 13: 3,854,277 G4R probably damaging Het
Carm1 T C 9: 21,569,512 V94A probably damaging Het
Ccnl1 A T 3: 65,947,744 S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 I168N probably benign Het
Ces2g C T 8: 104,966,973 R429C probably benign Het
Chd3 T C 11: 69,355,822 probably benign Het
Cmtr2 T A 8: 110,222,345 M429K probably benign Het
Cnga1 T G 5: 72,604,492 I560L probably benign Het
Col6a5 A G 9: 105,882,597 Y1975H probably damaging Het
Copb1 T C 7: 114,250,228 I47V probably benign Het
Crbn G A 6: 106,800,049 probably benign Het
Ddx41 A G 13: 55,533,126 L324P probably damaging Het
Dhx57 A G 17: 80,270,365 probably benign Het
Dlgap2 A T 8: 14,743,430 I475F probably benign Het
Dock2 T A 11: 34,727,460 K110* probably null Het
Dpp7 T C 2: 25,355,633 D147G probably damaging Het
Dync2h1 G T 9: 7,075,824 D3014E probably damaging Het
Efcab5 A T 11: 77,103,289 F1291I probably damaging Het
Endov T A 11: 119,491,910 V61D probably benign Het
Etv3 C A 3: 87,536,479 P457T possibly damaging Het
Fam185a T A 5: 21,433,768 H199Q probably benign Het
Fat3 T A 9: 15,967,101 E3361D probably benign Het
Fbn1 T C 2: 125,344,095 probably benign Het
Gm17079 A T 14: 51,695,330 W37R Het
Gpr68 T C 12: 100,879,033 H84R probably benign Het
Gramd1b A T 9: 40,304,378 S725R probably damaging Het
Greb1 T A 12: 16,696,547 T1241S probably benign Het
Hcn4 T C 9: 58,843,910 M273T probably benign Het
Hdlbp A G 1: 93,413,918 V973A probably damaging Het
Ighv8-11 A T 12: 115,567,544 probably benign Het
Itpkb A T 1: 180,421,781 Q907L probably benign Het
Lmo7 T A 14: 101,931,208 N1634K unknown Het
Lrrk1 C A 7: 66,302,729 L486F probably benign Het
Mdfic G A 6: 15,799,654 C260Y probably damaging Het
Mdh2 T C 5: 135,786,028 I140T probably benign Het
Myo9a T C 9: 59,875,374 V1775A probably benign Het
Olfr342 T C 2: 36,528,195 V261A probably benign Het
Olfr557 C A 7: 102,698,821 D194E probably damaging Het
Olfr665 T C 7: 104,881,555 Y283H probably damaging Het
P2rx2 C T 5: 110,342,514 V112I probably damaging Het
Rab25 T A 3: 88,545,081 R73S probably damaging Het
Rab8a TA TAA 8: 72,171,286 probably null Het
Rnf213 T C 11: 119,418,129 Y729H Het
Rnf213 A G 11: 119,441,212 T2417A Het
Rnft2 C A 5: 118,228,870 A268S probably benign Het
Samhd1 T C 2: 157,129,874 D116G probably benign Het
Sema6d T A 2: 124,665,017 V915E probably benign Het
Srcin1 C A 11: 97,523,542 R1045L probably damaging Het
St18 T A 1: 6,802,564 N174K probably benign Het
Stac3 G A 10: 127,503,625 C130Y probably damaging Het
Stum G C 1: 180,483,175 P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 E526K possibly damaging Het
Tiam1 A G 16: 89,898,012 S186P probably damaging Het
Tiparp G C 3: 65,553,542 V651L probably benign Het
Tmem19 C T 10: 115,343,860 G244S probably damaging Het
Trip11 A T 12: 101,873,397 V1658D possibly damaging Het
Ttyh3 A C 5: 140,627,189 Y453D probably damaging Het
Ttyh3 G T 5: 140,627,190 S452R probably benign Het
Ube2h C T 6: 30,262,339 probably benign Het
Zbtb4 T C 11: 69,776,792 S308P probably damaging Het
Zfyve1 T C 12: 83,550,907 E672G probably damaging Het
Zswim5 G A 4: 116,984,805 D861N probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAAAATATTAATGGGTCCACTTGC -3'
(R):5'- GGTTGCTTACTGTAAAATCCAAGC -3'

Sequencing Primer
(F):5'- ATGGGTCCACTTGCTTATACCTCAAG -3'
(R):5'- GCTTACTGTAAAATCCAAGCCAATTG -3'
Posted On 2021-04-30