Incidental Mutation 'R8690:Efcab5'
ID 668330
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R8690 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77089915-77188968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77103289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1291 (F1291I)
Ref Sequence ENSEMBL: ENSMUSP00000104037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably damaging
Transcript: ENSMUST00000108400
AA Change: F1291I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: F1291I

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130901
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Meta Mutation Damage Score 0.1487 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,061,172 T81S possibly damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Acbd5 T A 2: 23,089,698 S210T probably benign Het
Adam10 T A 9: 70,748,223 F324L probably damaging Het
Ak6 A G 13: 100,655,349 N100S possibly damaging Het
Angptl3 G T 4: 99,037,522 V362L probably benign Het
Ano9 C A 7: 141,104,307 W514L probably benign Het
Asb8 T C 15: 98,136,227 Y149C probably damaging Het
Bcl6b C A 11: 70,226,621 A392S probably damaging Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cad T A 5: 31,075,156 I1855N possibly damaging Het
Calm5 G A 13: 3,854,277 G4R probably damaging Het
Carm1 T C 9: 21,569,512 V94A probably damaging Het
Ccnl1 A T 3: 65,947,744 S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 I168N probably benign Het
Ces2g C T 8: 104,966,973 R429C probably benign Het
Chd3 T C 11: 69,355,822 probably benign Het
Cmtr2 T A 8: 110,222,345 M429K probably benign Het
Cnga1 T G 5: 72,604,492 I560L probably benign Het
Col6a5 A G 9: 105,882,597 Y1975H probably damaging Het
Copb1 T C 7: 114,250,228 I47V probably benign Het
Crbn G A 6: 106,800,049 probably benign Het
Ddx41 A G 13: 55,533,126 L324P probably damaging Het
Dhx57 A G 17: 80,270,365 probably benign Het
Dlgap2 A T 8: 14,743,430 I475F probably benign Het
Dock2 T A 11: 34,727,460 K110* probably null Het
Dpp7 T C 2: 25,355,633 D147G probably damaging Het
Dync2h1 G T 9: 7,075,824 D3014E probably damaging Het
Endov T A 11: 119,491,910 V61D probably benign Het
Etv3 C A 3: 87,536,479 P457T possibly damaging Het
Fam185a T A 5: 21,433,768 H199Q probably benign Het
Fat3 T A 9: 15,967,101 E3361D probably benign Het
Fbn1 T C 2: 125,344,095 probably benign Het
Gm17079 A T 14: 51,695,330 W37R Het
Gpr68 T C 12: 100,879,033 H84R probably benign Het
Gramd1b A T 9: 40,304,378 S725R probably damaging Het
Greb1 T A 12: 16,696,547 T1241S probably benign Het
Hcn4 T C 9: 58,843,910 M273T probably benign Het
Hdlbp A G 1: 93,413,918 V973A probably damaging Het
Ighv8-11 A T 12: 115,567,544 probably benign Het
Itpkb A T 1: 180,421,781 Q907L probably benign Het
Lmo7 T A 14: 101,931,208 N1634K unknown Het
Lrrk1 C A 7: 66,302,729 L486F probably benign Het
Mdfic G A 6: 15,799,654 C260Y probably damaging Het
Mdh2 T C 5: 135,786,028 I140T probably benign Het
Myo9a T C 9: 59,875,374 V1775A probably benign Het
Olfr342 T C 2: 36,528,195 V261A probably benign Het
Olfr557 C A 7: 102,698,821 D194E probably damaging Het
Olfr665 T C 7: 104,881,555 Y283H probably damaging Het
P2rx2 C T 5: 110,342,514 V112I probably damaging Het
Psme4 T A 11: 30,837,319 V1038E probably benign Het
Rab25 T A 3: 88,545,081 R73S probably damaging Het
Rab8a TA TAA 8: 72,171,286 probably null Het
Rnf213 T C 11: 119,418,129 Y729H Het
Rnf213 A G 11: 119,441,212 T2417A Het
Rnft2 C A 5: 118,228,870 A268S probably benign Het
Samhd1 T C 2: 157,129,874 D116G probably benign Het
Sema6d T A 2: 124,665,017 V915E probably benign Het
Srcin1 C A 11: 97,523,542 R1045L probably damaging Het
St18 T A 1: 6,802,564 N174K probably benign Het
Stac3 G A 10: 127,503,625 C130Y probably damaging Het
Stum G C 1: 180,483,175 P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 E526K possibly damaging Het
Tiam1 A G 16: 89,898,012 S186P probably damaging Het
Tiparp G C 3: 65,553,542 V651L probably benign Het
Tmem19 C T 10: 115,343,860 G244S probably damaging Het
Trip11 A T 12: 101,873,397 V1658D possibly damaging Het
Ttyh3 A C 5: 140,627,189 Y453D probably damaging Het
Ttyh3 G T 5: 140,627,190 S452R probably benign Het
Ube2h C T 6: 30,262,339 probably benign Het
Zbtb4 T C 11: 69,776,792 S308P probably damaging Het
Zfyve1 T C 12: 83,550,907 E672G probably damaging Het
Zswim5 G A 4: 116,984,805 D861N probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
R8213:Efcab5 UTSW 11 77116071 missense probably damaging 1.00
R9294:Efcab5 UTSW 11 77121238 missense probably benign 0.03
R9310:Efcab5 UTSW 11 77113705 missense probably benign 0.23
R9324:Efcab5 UTSW 11 77113720 missense possibly damaging 0.95
R9404:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9405:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCATGCACACTTGAGAGCTC -3'
(R):5'- TCCAGAGATGGAATCGGCAG -3'

Sequencing Primer
(F):5'- ACACTTGAGAGCTCGGGTG -3'
(R):5'- TCTTCCGAACCATGCTGCAGG -3'
Posted On 2021-04-30