Incidental Mutation 'R8690:Greb1'
ID668335
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8690 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16696547 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1241 (T1241S)
Ref Sequence ENSEMBL: ENSMUSP00000044454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably benign
Transcript: ENSMUST00000048064
AA Change: T1241S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: T1241S

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159120
AA Change: T1213S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: T1213S

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162112
AA Change: T1241S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: T1241S

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,061,172 T81S possibly damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Acbd5 T A 2: 23,089,698 S210T probably benign Het
Adam10 T A 9: 70,748,223 F324L probably damaging Het
Ak6 A G 13: 100,655,349 N100S possibly damaging Het
Angptl3 G T 4: 99,037,522 V362L probably benign Het
Ano9 C A 7: 141,104,307 W514L probably benign Het
Asb8 T C 15: 98,136,227 Y149C probably damaging Het
Bcl6b C A 11: 70,226,621 A392S probably damaging Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cad T A 5: 31,075,156 I1855N possibly damaging Het
Calm5 G A 13: 3,854,277 G4R probably damaging Het
Carm1 T C 9: 21,569,512 V94A probably damaging Het
Ccnl1 A T 3: 65,947,744 S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 I168N probably benign Het
Ces2g C T 8: 104,966,973 R429C probably benign Het
Chd3 T C 11: 69,355,822 probably benign Het
Cmtr2 T A 8: 110,222,345 M429K probably benign Het
Cnga1 T G 5: 72,604,492 I560L probably benign Het
Col6a5 A G 9: 105,882,597 Y1975H probably damaging Het
Copb1 T C 7: 114,250,228 I47V probably benign Het
Crbn G A 6: 106,800,049 probably benign Het
Ddx41 A G 13: 55,533,126 L324P probably damaging Het
Dhx57 A G 17: 80,270,365 probably benign Het
Dlgap2 A T 8: 14,743,430 I475F probably benign Het
Dock2 T A 11: 34,727,460 K110* probably null Het
Dpp7 T C 2: 25,355,633 D147G probably damaging Het
Dync2h1 G T 9: 7,075,824 D3014E probably damaging Het
Efcab5 A T 11: 77,103,289 F1291I probably damaging Het
Endov T A 11: 119,491,910 V61D probably benign Het
Etv3 C A 3: 87,536,479 P457T possibly damaging Het
Fam185a T A 5: 21,433,768 H199Q probably benign Het
Fat3 T A 9: 15,967,101 E3361D probably benign Het
Fbn1 T C 2: 125,344,095 probably benign Het
Gm17079 A T 14: 51,695,330 W37R Het
Gpr68 T C 12: 100,879,033 H84R probably benign Het
Gramd1b A T 9: 40,304,378 S725R probably damaging Het
Hcn4 T C 9: 58,843,910 M273T probably benign Het
Hdlbp A G 1: 93,413,918 V973A probably damaging Het
Ighv8-11 A T 12: 115,567,544 probably benign Het
Itpkb A T 1: 180,421,781 Q907L probably benign Het
Lmo7 T A 14: 101,931,208 N1634K unknown Het
Lrrk1 C A 7: 66,302,729 L486F probably benign Het
Mdfic G A 6: 15,799,654 C260Y probably damaging Het
Mdh2 T C 5: 135,786,028 I140T probably benign Het
Myo9a T C 9: 59,875,374 V1775A probably benign Het
Olfr342 T C 2: 36,528,195 V261A probably benign Het
Olfr557 C A 7: 102,698,821 D194E probably damaging Het
Olfr665 T C 7: 104,881,555 Y283H probably damaging Het
P2rx2 C T 5: 110,342,514 V112I probably damaging Het
Psme4 T A 11: 30,837,319 V1038E probably benign Het
Rab25 T A 3: 88,545,081 R73S probably damaging Het
Rab8a TA TAA 8: 72,171,286 probably null Het
Rnf213 T C 11: 119,418,129 Y729H Het
Rnf213 A G 11: 119,441,212 T2417A Het
Rnft2 C A 5: 118,228,870 A268S probably benign Het
Samhd1 T C 2: 157,129,874 D116G probably benign Het
Sema6d T A 2: 124,665,017 V915E probably benign Het
Srcin1 C A 11: 97,523,542 R1045L probably damaging Het
St18 T A 1: 6,802,564 N174K probably benign Het
Stac3 G A 10: 127,503,625 C130Y probably damaging Het
Stum G C 1: 180,483,175 P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 E526K possibly damaging Het
Tiam1 A G 16: 89,898,012 S186P probably damaging Het
Tiparp G C 3: 65,553,542 V651L probably benign Het
Tmem19 C T 10: 115,343,860 G244S probably damaging Het
Trip11 A T 12: 101,873,397 V1658D possibly damaging Het
Ttyh3 A C 5: 140,627,189 Y453D probably damaging Het
Ttyh3 G T 5: 140,627,190 S452R probably benign Het
Ube2h C T 6: 30,262,339 probably benign Het
Zbtb4 T C 11: 69,776,792 S308P probably damaging Het
Zfyve1 T C 12: 83,550,907 E672G probably damaging Het
Zswim5 G A 4: 116,984,805 D861N probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
G1patch:Greb1 UTSW 12 16688567 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R7937:Greb1 UTSW 12 16716669 missense probably damaging 0.99
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
R8553:Greb1 UTSW 12 16723327 missense probably benign 0.00
R8559:Greb1 UTSW 12 16696435 missense probably damaging 1.00
R8830:Greb1 UTSW 12 16688519 missense probably benign 0.35
R8911:Greb1 UTSW 12 16690902 missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16724884 missense probably damaging 1.00
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGGTCCACATGACTGAAG -3'
(R):5'- CAGATCACCTCCATCCTGTG -3'

Sequencing Primer
(F):5'- TCCACATGACTGAAGGGGAAG -3'
(R):5'- ATCCTGTGGCCCTGCAGAG -3'
Posted On2021-04-30