Incidental Mutation 'R8690:Dhx57'
ID 668348
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R8690 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 80238304-80290476 bp(-) (GRCm38)
Type of Mutation critical splice donor site
DNA Base Change (assembly) A to G at 80270365 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably benign
Transcript: ENSMUST00000038166
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086555
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (73/73)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik T A 12: 55,061,172 T81S possibly damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Acbd5 T A 2: 23,089,698 S210T probably benign Het
Adam10 T A 9: 70,748,223 F324L probably damaging Het
Ak6 A G 13: 100,655,349 N100S possibly damaging Het
Angptl3 G T 4: 99,037,522 V362L probably benign Het
Ano9 C A 7: 141,104,307 W514L probably benign Het
Asb8 T C 15: 98,136,227 Y149C probably damaging Het
Bcl6b C A 11: 70,226,621 A392S probably damaging Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cad T A 5: 31,075,156 I1855N possibly damaging Het
Calm5 G A 13: 3,854,277 G4R probably damaging Het
Carm1 T C 9: 21,569,512 V94A probably damaging Het
Ccnl1 A T 3: 65,947,744 S399R possibly damaging Het
Cdh17 T A 4: 11,783,163 I168N probably benign Het
Ces2g C T 8: 104,966,973 R429C probably benign Het
Chd3 T C 11: 69,355,822 probably benign Het
Cmtr2 T A 8: 110,222,345 M429K probably benign Het
Cnga1 T G 5: 72,604,492 I560L probably benign Het
Col6a5 A G 9: 105,882,597 Y1975H probably damaging Het
Copb1 T C 7: 114,250,228 I47V probably benign Het
Crbn G A 6: 106,800,049 probably benign Het
Ddx41 A G 13: 55,533,126 L324P probably damaging Het
Dlgap2 A T 8: 14,743,430 I475F probably benign Het
Dock2 T A 11: 34,727,460 K110* probably null Het
Dpp7 T C 2: 25,355,633 D147G probably damaging Het
Dync2h1 G T 9: 7,075,824 D3014E probably damaging Het
Efcab5 A T 11: 77,103,289 F1291I probably damaging Het
Endov T A 11: 119,491,910 V61D probably benign Het
Etv3 C A 3: 87,536,479 P457T possibly damaging Het
Fam185a T A 5: 21,433,768 H199Q probably benign Het
Fat3 T A 9: 15,967,101 E3361D probably benign Het
Fbn1 T C 2: 125,344,095 probably benign Het
Gm17079 A T 14: 51,695,330 W37R Het
Gpr68 T C 12: 100,879,033 H84R probably benign Het
Gramd1b A T 9: 40,304,378 S725R probably damaging Het
Greb1 T A 12: 16,696,547 T1241S probably benign Het
Hcn4 T C 9: 58,843,910 M273T probably benign Het
Hdlbp A G 1: 93,413,918 V973A probably damaging Het
Ighv8-11 A T 12: 115,567,544 probably benign Het
Itpkb A T 1: 180,421,781 Q907L probably benign Het
Lmo7 T A 14: 101,931,208 N1634K unknown Het
Lrrk1 C A 7: 66,302,729 L486F probably benign Het
Mdfic G A 6: 15,799,654 C260Y probably damaging Het
Mdh2 T C 5: 135,786,028 I140T probably benign Het
Myo9a T C 9: 59,875,374 V1775A probably benign Het
Olfr342 T C 2: 36,528,195 V261A probably benign Het
Olfr557 C A 7: 102,698,821 D194E probably damaging Het
Olfr665 T C 7: 104,881,555 Y283H probably damaging Het
P2rx2 C T 5: 110,342,514 V112I probably damaging Het
Psme4 T A 11: 30,837,319 V1038E probably benign Het
Rab25 T A 3: 88,545,081 R73S probably damaging Het
Rab8a TA TAA 8: 72,171,286 probably null Het
Rnf213 T C 11: 119,418,129 Y729H Het
Rnf213 A G 11: 119,441,212 T2417A Het
Rnft2 C A 5: 118,228,870 A268S probably benign Het
Samhd1 T C 2: 157,129,874 D116G probably benign Het
Sema6d T A 2: 124,665,017 V915E probably benign Het
Srcin1 C A 11: 97,523,542 R1045L probably damaging Het
St18 T A 1: 6,802,564 N174K probably benign Het
Stac3 G A 10: 127,503,625 C130Y probably damaging Het
Stum G C 1: 180,483,175 P52R probably damaging Het
Tbc1d2 C T 4: 46,615,106 E526K possibly damaging Het
Tiam1 A G 16: 89,898,012 S186P probably damaging Het
Tiparp G C 3: 65,553,542 V651L probably benign Het
Tmem19 C T 10: 115,343,860 G244S probably damaging Het
Trip11 A T 12: 101,873,397 V1658D possibly damaging Het
Ttyh3 A C 5: 140,627,189 Y453D probably damaging Het
Ttyh3 G T 5: 140,627,190 S452R probably benign Het
Ube2h C T 6: 30,262,339 probably benign Het
Zbtb4 T C 11: 69,776,792 S308P probably damaging Het
Zfyve1 T C 12: 83,550,907 E672G probably damaging Het
Zswim5 G A 4: 116,984,805 D861N probably damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80245763 missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80275490 missense probably benign 0.18
R8403:Dhx57 UTSW 17 80278289 missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80254424 missense probably damaging 1.00
R9210:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80242094 missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80254388 missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80245701 missense probably benign 0.09
R9717:Dhx57 UTSW 17 80275018 missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGGTGAATTTCTGAGCTCC -3'
(R):5'- AGGCACATTGTATCGTGGGC -3'

Sequencing Primer
(F):5'- TGAATTTCTGAGCTCCATTTTAGG -3'
(R):5'- CACATTGTATCGTGGGCTTTGAAG -3'
Posted On 2021-04-30