Incidental Mutation 'R8691:Itch'
ID668354
Institutional Source Beutler Lab
Gene Symbol Itch
Ensembl Gene ENSMUSG00000027598
Gene Nameitchy, E3 ubiquitin protein ligase
Synonyms8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8691 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155133509-155226855 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 155210558 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 693 (E693*)
Ref Sequence ENSEMBL: ENSMUSP00000029126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]
PDB Structure Itch E3 ubiquitin ligase WW3 domain [SOLUTION NMR]
Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED [SOLUTION NMR]
Mouse Itch 3rd domain phosphorylated in T30 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000029126
AA Change: E693*
SMART Domains Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: E693*

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109685
AA Change: E693*
SMART Domains Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: E693*

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G T 5: 30,105,289 A24E unknown Het
9530053A07Rik A T 7: 28,153,839 E1517V possibly damaging Het
Acap1 A G 11: 69,890,177 L117P probably damaging Het
Actl6b G A 5: 137,567,323 G394S probably damaging Het
Actr3b G T 5: 25,825,204 V177F possibly damaging Het
Adamts6 A G 13: 104,314,331 T341A probably benign Het
Agbl4 G T 4: 111,662,959 V474F probably benign Het
Bach1 T C 16: 87,719,629 S353P probably benign Het
C1qtnf9 G A 14: 60,779,692 D224N probably damaging Het
Camkmt A T 17: 85,113,832 N121Y probably damaging Het
Card6 A T 15: 5,099,596 Y773N possibly damaging Het
Cbfa2t2 C A 2: 154,500,483 P40T possibly damaging Het
Colec10 A C 15: 54,435,024 E60D probably benign Het
Cspg4 T C 9: 56,892,996 V1647A probably benign Het
Cyp2d34 A G 15: 82,618,270 F222L probably benign Het
Dennd1b A T 1: 139,042,036 I97F possibly damaging Het
Deptor A C 15: 55,220,200 D388A possibly damaging Het
Dhx40 T C 11: 86,799,593 K201E possibly damaging Het
Diexf T C 1: 193,113,802 E673G probably benign Het
Dnah6 G A 6: 73,168,867 R854C probably damaging Het
Dock9 T C 14: 121,640,105 I409V possibly damaging Het
Esp31 G T 17: 38,644,701 L78F possibly damaging Het
Fam214a A T 9: 75,010,053 T652S probably benign Het
Fam98c A T 7: 29,153,464 V48E probably damaging Het
Fgfr1 A T 8: 25,562,237 D193V possibly damaging Het
Furin C T 7: 80,392,027 probably benign Het
Gm17078 A T 14: 51,611,236 F15I probably damaging Het
Gm6803 T G 12: 88,018,508 K88N probably damaging Het
Grid2 G T 6: 63,503,337 R45L probably damaging Het
Hecw2 A G 1: 53,865,064 V1175A probably benign Het
Hspa1b T C 17: 34,957,096 I638V possibly damaging Het
Ighv6-7 A G 12: 114,455,684 V100A probably benign Het
Ivl G A 3: 92,571,516 S414L unknown Het
Kif5b T A 18: 6,225,787 N160I probably benign Het
Klhl5 A G 5: 65,149,538 probably benign Het
Lpin1 C T 12: 16,573,659 probably benign Het
Malsu1 C A 6: 49,075,237 H130Q probably benign Het
Naip2 A C 13: 100,161,168 L787V probably damaging Het
Nynrin C T 14: 55,872,649 R1738W probably damaging Het
Olfr1508 A T 14: 52,463,901 I36N possibly damaging Het
Olfr557 C T 7: 102,698,570 Q111* probably null Het
Olfr743 A G 14: 50,533,453 T14A probably benign Het
Olfr872 T A 9: 20,260,451 S204T probably benign Het
Pclo A G 5: 14,521,692 T364A unknown Het
Phlda2 A C 7: 143,502,469 S8A probably benign Het
Pou3f1 G A 4: 124,657,756 G17E unknown Het
Ppfibp2 A G 7: 107,747,578 D899G probably damaging Het
Pskh1 T C 8: 105,913,201 V171A probably damaging Het
Rictor A G 15: 6,787,032 T1262A probably damaging Het
Rnf41 T C 10: 128,438,208 V243A probably benign Het
Slc9c1 T A 16: 45,606,819 N1162K probably benign Het
Spef2 A T 15: 9,601,919 L1419* probably null Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnc A G 4: 63,962,076 C1954R probably damaging Het
Ttll11 T A 2: 35,784,149 I622F probably damaging Het
Vmn2r104 A G 17: 20,041,848 I340T probably damaging Het
Vmn2r110 G T 17: 20,583,142 D390E probably benign Het
Other mutations in Itch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Itch APN 2 155213023 missense probably damaging 1.00
IGL00796:Itch APN 2 155209082 missense probably damaging 0.97
IGL01090:Itch APN 2 155206336 missense probably damaging 0.99
IGL01568:Itch APN 2 155212462 splice site probably benign
IGL01844:Itch APN 2 155172547 missense possibly damaging 0.56
IGL01844:Itch APN 2 155172486 missense possibly damaging 0.94
IGL01873:Itch APN 2 155168750 missense possibly damaging 0.68
IGL02129:Itch APN 2 155217988 splice site probably benign
IGL02386:Itch APN 2 155202261 nonsense probably null
IGL02545:Itch APN 2 155172586 splice site probably null
IGL02621:Itch APN 2 155172584 splice site probably null
IGL02708:Itch APN 2 155174044 missense probably benign 0.00
IGL02869:Itch APN 2 155173933 critical splice acceptor site probably null
Abrade UTSW 2 155209078 missense possibly damaging 0.93
dorsolateral UTSW 2 155210558 nonsense probably null
gadfly UTSW 2 155182298 nonsense probably null
hankerin UTSW 2 155210582 critical splice donor site probably null
prurient UTSW 2 155210502 missense probably damaging 1.00
scratch UTSW 2 155172561 missense probably damaging 0.99
R0116:Itch UTSW 2 155217983 splice site probably benign
R0207:Itch UTSW 2 155202257 missense probably benign
R0226:Itch UTSW 2 155199394 missense probably benign 0.01
R0545:Itch UTSW 2 155182298 nonsense probably null
R0689:Itch UTSW 2 155182178 missense possibly damaging 0.82
R1365:Itch UTSW 2 155213031 missense probably benign 0.00
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1436:Itch UTSW 2 155192145 missense probably damaging 0.96
R1639:Itch UTSW 2 155179025 splice site probably null
R1769:Itch UTSW 2 155172561 missense probably damaging 0.99
R1855:Itch UTSW 2 155172454 splice site probably benign
R1865:Itch UTSW 2 155168746 missense probably damaging 0.96
R2008:Itch UTSW 2 155210459 missense possibly damaging 0.91
R2054:Itch UTSW 2 155210576 missense probably damaging 1.00
R2196:Itch UTSW 2 155202221 missense probably benign
R2199:Itch UTSW 2 155202221 missense probably benign
R2252:Itch UTSW 2 155212339 missense probably benign 0.01
R2253:Itch UTSW 2 155212339 missense probably benign 0.01
R2348:Itch UTSW 2 155209078 missense possibly damaging 0.93
R2850:Itch UTSW 2 155202221 missense probably benign
R3021:Itch UTSW 2 155209126 missense possibly damaging 0.74
R4676:Itch UTSW 2 155199435 missense probably benign 0.05
R4716:Itch UTSW 2 155210582 critical splice donor site probably null
R4888:Itch UTSW 2 155217977 splice site probably null
R4970:Itch UTSW 2 155185593 missense possibly damaging 0.50
R6029:Itch UTSW 2 155179089 critical splice donor site probably null
R6122:Itch UTSW 2 155174065 missense probably benign 0.05
R6435:Itch UTSW 2 155209129 missense probably benign 0.01
R6449:Itch UTSW 2 155163395 splice site probably benign
R7069:Itch UTSW 2 155209994 missense probably damaging 1.00
R7083:Itch UTSW 2 155210444 missense probably damaging 1.00
R7409:Itch UTSW 2 155199382 missense probably damaging 0.99
R7689:Itch UTSW 2 155210002 missense probably damaging 0.99
R7689:Itch UTSW 2 155213067 missense probably benign 0.00
R7974:Itch UTSW 2 155192159 missense probably damaging 1.00
R8046:Itch UTSW 2 155210502 missense probably damaging 1.00
R8248:Itch UTSW 2 155206383 critical splice donor site probably null
R8355:Itch UTSW 2 155210582 critical splice donor site probably null
R8428:Itch UTSW 2 155168707 missense probably benign 0.38
R8779:Itch UTSW 2 155172520 missense probably benign 0.28
Z1177:Itch UTSW 2 155209059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCATCCAAGGTCTTAAGTAGTAAC -3'
(R):5'- ATGCCACCCTTTACCATTATTAGAC -3'

Sequencing Primer
(F):5'- GGCTTATTGCTTAAACTCAGAATTTG -3'
(R):5'- GTACACGCTATGCTCCTGAGTG -3'
Posted On2021-04-30