Incidental Mutation 'R8691:Fcgbpl1'
ID 668366
Institutional Source Beutler Lab
Gene Symbol Fcgbpl1
Ensembl Gene ENSMUSG00000078776
Gene Name Fc fragment of IgG binding protein like 1
Synonyms 9530053A07Rik
MMRRC Submission 068545-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8691 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 27828891-27864236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27853264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 1517 (E1517V)
Ref Sequence ENSEMBL: ENSMUSP00000056479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect possibly damaging
Transcript: ENSMUST00000059886
AA Change: E1517V

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: E1517V

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150948
AA Change: E1517V

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: E1517V

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G T 5: 30,310,287 (GRCm39) A24E unknown Het
Acap1 A G 11: 69,781,003 (GRCm39) L117P probably damaging Het
Actl6b G A 5: 137,565,585 (GRCm39) G394S probably damaging Het
Actr3b G T 5: 26,030,202 (GRCm39) V177F possibly damaging Het
Adamts6 A G 13: 104,450,839 (GRCm39) T341A probably benign Het
Agbl4 G T 4: 111,520,156 (GRCm39) V474F probably benign Het
Atosa A T 9: 74,917,335 (GRCm39) T652S probably benign Het
Bach1 T C 16: 87,516,517 (GRCm39) S353P probably benign Het
C1qtnf9 G A 14: 61,017,141 (GRCm39) D224N probably damaging Het
Camkmt A T 17: 85,421,260 (GRCm39) N121Y probably damaging Het
Card6 A T 15: 5,129,078 (GRCm39) Y773N possibly damaging Het
Cbfa2t2 C A 2: 154,342,403 (GRCm39) P40T possibly damaging Het
Colec10 A C 15: 54,298,420 (GRCm39) E60D probably benign Het
Cspg4 T C 9: 56,800,280 (GRCm39) V1647A probably benign Het
Cyp2d34 A G 15: 82,502,471 (GRCm39) F222L probably benign Het
Dennd1b A T 1: 138,969,774 (GRCm39) I97F possibly damaging Het
Deptor A C 15: 55,083,596 (GRCm39) D388A possibly damaging Het
Dhx40 T C 11: 86,690,419 (GRCm39) K201E possibly damaging Het
Dnah6 G A 6: 73,145,850 (GRCm39) R854C probably damaging Het
Dock9 T C 14: 121,877,517 (GRCm39) I409V possibly damaging Het
Eif1ad16 T G 12: 87,985,278 (GRCm39) K88N probably damaging Het
Esp31 G T 17: 38,955,592 (GRCm39) L78F possibly damaging Het
Fam98c A T 7: 28,852,889 (GRCm39) V48E probably damaging Het
Fgfr1 A T 8: 26,052,253 (GRCm39) D193V possibly damaging Het
Furin C T 7: 80,041,775 (GRCm39) probably benign Het
Gm17078 A T 14: 51,848,693 (GRCm39) F15I probably damaging Het
Grid2 G T 6: 63,480,321 (GRCm39) R45L probably damaging Het
Hecw2 A G 1: 53,904,223 (GRCm39) V1175A probably benign Het
Hspa1b T C 17: 35,176,072 (GRCm39) I638V possibly damaging Het
Ighv6-7 A G 12: 114,419,304 (GRCm39) V100A probably benign Het
Itch G T 2: 155,052,478 (GRCm39) E693* probably null Het
Ivl G A 3: 92,478,823 (GRCm39) S414L unknown Het
Kif5b T A 18: 6,225,787 (GRCm39) N160I probably benign Het
Klhl5 A G 5: 65,306,881 (GRCm39) probably benign Het
Lpin1 C T 12: 16,623,660 (GRCm39) probably benign Het
Malsu1 C A 6: 49,052,171 (GRCm39) H130Q probably benign Het
Naip2 A C 13: 100,297,676 (GRCm39) L787V probably damaging Het
Nynrin C T 14: 56,110,106 (GRCm39) R1738W probably damaging Het
Or11g27 A G 14: 50,770,910 (GRCm39) T14A probably benign Het
Or4e1 A T 14: 52,701,358 (GRCm39) I36N possibly damaging Het
Or51d1 C T 7: 102,347,777 (GRCm39) Q111* probably null Het
Or7e176 T A 9: 20,171,747 (GRCm39) S204T probably benign Het
Pclo A G 5: 14,571,706 (GRCm39) T364A unknown Het
Phlda2 A C 7: 143,056,206 (GRCm39) S8A probably benign Het
Pou3f1 G A 4: 124,551,549 (GRCm39) G17E unknown Het
Ppfibp2 A G 7: 107,346,785 (GRCm39) D899G probably damaging Het
Pskh1 T C 8: 106,639,833 (GRCm39) V171A probably damaging Het
Rictor A G 15: 6,816,513 (GRCm39) T1262A probably damaging Het
Rnf41 T C 10: 128,274,077 (GRCm39) V243A probably benign Het
Slc9c1 T A 16: 45,427,182 (GRCm39) N1162K probably benign Het
Spef2 A T 15: 9,602,005 (GRCm39) L1419* probably null Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tnc A G 4: 63,880,313 (GRCm39) C1954R probably damaging Het
Ttll11 T A 2: 35,674,161 (GRCm39) I622F probably damaging Het
Utp25 T C 1: 192,796,110 (GRCm39) E673G probably benign Het
Vmn2r104 A G 17: 20,262,110 (GRCm39) I340T probably damaging Het
Vmn2r110 G T 17: 20,803,404 (GRCm39) D390E probably benign Het
Other mutations in Fcgbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fcgbpl1 APN 7 27,863,953 (GRCm39) missense probably damaging 1.00
IGL00757:Fcgbpl1 APN 7 27,853,870 (GRCm39) missense probably damaging 1.00
IGL01015:Fcgbpl1 APN 7 27,854,743 (GRCm39) missense probably damaging 1.00
IGL01079:Fcgbpl1 APN 7 27,839,203 (GRCm39) missense probably damaging 0.99
IGL01343:Fcgbpl1 APN 7 27,850,127 (GRCm39) missense probably benign 0.19
IGL01420:Fcgbpl1 APN 7 27,839,558 (GRCm39) missense probably benign 0.28
IGL01604:Fcgbpl1 APN 7 27,854,749 (GRCm39) missense probably benign 0.11
IGL01666:Fcgbpl1 APN 7 27,852,717 (GRCm39) missense probably damaging 1.00
IGL02002:Fcgbpl1 APN 7 27,852,221 (GRCm39) missense probably damaging 1.00
IGL02036:Fcgbpl1 APN 7 27,836,950 (GRCm39) missense possibly damaging 0.82
IGL02126:Fcgbpl1 APN 7 27,839,281 (GRCm39) missense probably damaging 1.00
IGL02150:Fcgbpl1 APN 7 27,846,204 (GRCm39) nonsense probably null
IGL02219:Fcgbpl1 APN 7 27,854,060 (GRCm39) missense probably damaging 1.00
IGL02563:Fcgbpl1 APN 7 27,857,317 (GRCm39) missense probably benign
IGL02804:Fcgbpl1 APN 7 27,852,795 (GRCm39) missense probably benign 0.00
IGL02830:Fcgbpl1 APN 7 27,862,348 (GRCm39) missense probably damaging 1.00
IGL02943:Fcgbpl1 APN 7 27,846,613 (GRCm39) missense probably damaging 1.00
IGL02977:Fcgbpl1 APN 7 27,863,797 (GRCm39) missense possibly damaging 0.83
IGL03231:Fcgbpl1 APN 7 27,853,147 (GRCm39) missense possibly damaging 0.95
IGL03304:Fcgbpl1 APN 7 27,841,667 (GRCm39) missense probably damaging 0.99
herz UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
pulse UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
Sinusoidal UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
PIT4378001:Fcgbpl1 UTSW 7 27,853,889 (GRCm39) missense possibly damaging 0.61
R0023:Fcgbpl1 UTSW 7 27,852,837 (GRCm39) missense probably benign 0.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0132:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0158:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R0230:Fcgbpl1 UTSW 7 27,856,250 (GRCm39) missense probably damaging 1.00
R0310:Fcgbpl1 UTSW 7 27,841,699 (GRCm39) missense probably benign 0.04
R0448:Fcgbpl1 UTSW 7 27,839,660 (GRCm39) missense probably benign 0.03
R0462:Fcgbpl1 UTSW 7 27,836,765 (GRCm39) missense probably damaging 1.00
R0481:Fcgbpl1 UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
R0497:Fcgbpl1 UTSW 7 27,846,890 (GRCm39) missense probably damaging 1.00
R0556:Fcgbpl1 UTSW 7 27,858,803 (GRCm39) missense probably benign
R0562:Fcgbpl1 UTSW 7 27,862,115 (GRCm39) missense probably benign 0.30
R0586:Fcgbpl1 UTSW 7 27,836,516 (GRCm39) missense probably damaging 0.99
R0924:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R0930:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R1103:Fcgbpl1 UTSW 7 27,853,945 (GRCm39) missense probably damaging 1.00
R1213:Fcgbpl1 UTSW 7 27,857,098 (GRCm39) missense probably damaging 1.00
R1292:Fcgbpl1 UTSW 7 27,842,219 (GRCm39) splice site probably benign
R1368:Fcgbpl1 UTSW 7 27,858,903 (GRCm39) missense possibly damaging 0.89
R1451:Fcgbpl1 UTSW 7 27,836,582 (GRCm39) missense probably damaging 1.00
R1477:Fcgbpl1 UTSW 7 27,856,518 (GRCm39) missense probably benign 0.01
R1538:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R1655:Fcgbpl1 UTSW 7 27,846,535 (GRCm39) missense probably damaging 0.98
R1697:Fcgbpl1 UTSW 7 27,853,772 (GRCm39) missense probably damaging 1.00
R1741:Fcgbpl1 UTSW 7 27,857,279 (GRCm39) missense probably damaging 0.98
R1796:Fcgbpl1 UTSW 7 27,854,797 (GRCm39) missense probably damaging 1.00
R1853:Fcgbpl1 UTSW 7 27,854,971 (GRCm39) nonsense probably null
R1861:Fcgbpl1 UTSW 7 27,854,157 (GRCm39) missense probably damaging 1.00
R1909:Fcgbpl1 UTSW 7 27,843,773 (GRCm39) missense possibly damaging 0.52
R1971:Fcgbpl1 UTSW 7 27,830,937 (GRCm39) missense possibly damaging 0.90
R1990:Fcgbpl1 UTSW 7 27,853,785 (GRCm39) missense probably damaging 0.98
R2020:Fcgbpl1 UTSW 7 27,855,019 (GRCm39) missense probably benign
R2084:Fcgbpl1 UTSW 7 27,856,960 (GRCm39) missense probably damaging 1.00
R2125:Fcgbpl1 UTSW 7 27,857,447 (GRCm39) missense probably benign 0.00
R2132:Fcgbpl1 UTSW 7 27,854,899 (GRCm39) missense probably damaging 1.00
R2513:Fcgbpl1 UTSW 7 27,831,060 (GRCm39) missense probably damaging 0.99
R2913:Fcgbpl1 UTSW 7 27,863,732 (GRCm39) missense probably damaging 1.00
R3150:Fcgbpl1 UTSW 7 27,853,620 (GRCm39) missense probably benign 0.21
R3499:Fcgbpl1 UTSW 7 27,853,980 (GRCm39) missense probably benign 0.42
R3702:Fcgbpl1 UTSW 7 27,857,203 (GRCm39) missense probably damaging 1.00
R3881:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R3938:Fcgbpl1 UTSW 7 27,853,719 (GRCm39) missense probably damaging 1.00
R4050:Fcgbpl1 UTSW 7 27,852,410 (GRCm39) missense possibly damaging 0.55
R4152:Fcgbpl1 UTSW 7 27,856,322 (GRCm39) missense possibly damaging 0.47
R4168:Fcgbpl1 UTSW 7 27,836,534 (GRCm39) missense probably benign 0.05
R4235:Fcgbpl1 UTSW 7 27,856,073 (GRCm39) missense probably damaging 0.99
R4241:Fcgbpl1 UTSW 7 27,853,760 (GRCm39) missense probably damaging 1.00
R4363:Fcgbpl1 UTSW 7 27,846,331 (GRCm39) missense probably damaging 1.00
R4460:Fcgbpl1 UTSW 7 27,852,281 (GRCm39) missense probably benign 0.17
R4463:Fcgbpl1 UTSW 7 27,850,144 (GRCm39) missense probably benign
R4841:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4842:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4876:Fcgbpl1 UTSW 7 27,842,225 (GRCm39) intron probably benign
R4905:Fcgbpl1 UTSW 7 27,856,408 (GRCm39) missense possibly damaging 0.93
R4997:Fcgbpl1 UTSW 7 27,843,349 (GRCm39) missense possibly damaging 0.77
R5091:Fcgbpl1 UTSW 7 27,856,383 (GRCm39) missense probably benign 0.44
R5159:Fcgbpl1 UTSW 7 27,852,733 (GRCm39) missense probably benign 0.09
R5326:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5396:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign
R5441:Fcgbpl1 UTSW 7 27,856,339 (GRCm39) missense probably damaging 1.00
R5480:Fcgbpl1 UTSW 7 27,857,424 (GRCm39) nonsense probably null
R5542:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5571:Fcgbpl1 UTSW 7 27,855,994 (GRCm39) missense probably damaging 0.99
R5613:Fcgbpl1 UTSW 7 27,842,303 (GRCm39) intron probably benign
R5637:Fcgbpl1 UTSW 7 27,852,277 (GRCm39) missense probably benign 0.00
R5766:Fcgbpl1 UTSW 7 27,836,754 (GRCm39) nonsense probably null
R6174:Fcgbpl1 UTSW 7 27,839,384 (GRCm39) missense probably damaging 0.96
R6233:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R6250:Fcgbpl1 UTSW 7 27,850,139 (GRCm39) missense probably damaging 1.00
R6379:Fcgbpl1 UTSW 7 27,857,017 (GRCm39) missense probably damaging 1.00
R6442:Fcgbpl1 UTSW 7 27,843,611 (GRCm39) missense possibly damaging 0.88
R6478:Fcgbpl1 UTSW 7 27,854,798 (GRCm39) missense probably damaging 1.00
R6699:Fcgbpl1 UTSW 7 27,843,793 (GRCm39) missense probably damaging 1.00
R6852:Fcgbpl1 UTSW 7 27,846,560 (GRCm39) missense probably damaging 1.00
R6883:Fcgbpl1 UTSW 7 27,852,260 (GRCm39) missense possibly damaging 0.89
R6902:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6903:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6904:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6992:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign 0.04
R7023:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R7039:Fcgbpl1 UTSW 7 27,839,573 (GRCm39) missense possibly damaging 0.80
R7171:Fcgbpl1 UTSW 7 27,853,944 (GRCm39) nonsense probably null
R7282:Fcgbpl1 UTSW 7 27,843,833 (GRCm39) missense probably benign 0.02
R7291:Fcgbpl1 UTSW 7 27,839,645 (GRCm39) missense probably benign
R7344:Fcgbpl1 UTSW 7 27,852,185 (GRCm39) missense possibly damaging 0.46
R7344:Fcgbpl1 UTSW 7 27,839,704 (GRCm39) missense possibly damaging 0.79
R7392:Fcgbpl1 UTSW 7 27,863,797 (GRCm39) missense possibly damaging 0.83
R7531:Fcgbpl1 UTSW 7 27,839,656 (GRCm39) missense probably benign
R7541:Fcgbpl1 UTSW 7 27,843,681 (GRCm39) nonsense probably null
R7577:Fcgbpl1 UTSW 7 27,853,848 (GRCm39) missense possibly damaging 0.65
R7594:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R7647:Fcgbpl1 UTSW 7 27,839,470 (GRCm39) missense probably benign 0.00
R7718:Fcgbpl1 UTSW 7 27,846,626 (GRCm39) missense probably damaging 1.00
R7733:Fcgbpl1 UTSW 7 27,839,390 (GRCm39) missense probably damaging 1.00
R7737:Fcgbpl1 UTSW 7 27,856,498 (GRCm39) missense probably damaging 1.00
R7908:Fcgbpl1 UTSW 7 27,846,921 (GRCm39) missense probably benign 0.12
R8013:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8014:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8151:Fcgbpl1 UTSW 7 27,852,766 (GRCm39) missense possibly damaging 0.95
R8175:Fcgbpl1 UTSW 7 27,863,873 (GRCm39) nonsense probably null
R8254:Fcgbpl1 UTSW 7 27,846,774 (GRCm39) missense possibly damaging 0.63
R8345:Fcgbpl1 UTSW 7 27,854,785 (GRCm39) missense probably damaging 1.00
R8414:Fcgbpl1 UTSW 7 27,842,158 (GRCm39) missense probably damaging 1.00
R8419:Fcgbpl1 UTSW 7 27,843,346 (GRCm39) missense probably damaging 1.00
R8496:Fcgbpl1 UTSW 7 27,843,377 (GRCm39) missense possibly damaging 0.81
R8785:Fcgbpl1 UTSW 7 27,854,132 (GRCm39) missense probably damaging 1.00
R8863:Fcgbpl1 UTSW 7 27,831,006 (GRCm39) missense probably damaging 1.00
R8926:Fcgbpl1 UTSW 7 27,853,869 (GRCm39) missense probably damaging 1.00
R8950:Fcgbpl1 UTSW 7 27,863,751 (GRCm39) missense probably benign 0.32
R9014:Fcgbpl1 UTSW 7 27,854,876 (GRCm39) missense probably damaging 1.00
R9045:Fcgbpl1 UTSW 7 27,853,856 (GRCm39) missense probably damaging 1.00
R9115:Fcgbpl1 UTSW 7 27,853,754 (GRCm39) missense possibly damaging 0.74
R9233:Fcgbpl1 UTSW 7 27,839,519 (GRCm39) missense possibly damaging 0.83
R9330:Fcgbpl1 UTSW 7 27,856,410 (GRCm39) missense probably benign 0.02
R9426:Fcgbpl1 UTSW 7 27,843,281 (GRCm39) missense possibly damaging 0.92
R9477:Fcgbpl1 UTSW 7 27,852,265 (GRCm39) missense probably damaging 1.00
R9502:Fcgbpl1 UTSW 7 27,836,891 (GRCm39) missense probably benign 0.09
R9505:Fcgbpl1 UTSW 7 27,841,909 (GRCm39) nonsense probably null
R9601:Fcgbpl1 UTSW 7 27,853,805 (GRCm39) missense possibly damaging 0.78
R9630:Fcgbpl1 UTSW 7 27,836,624 (GRCm39) missense probably damaging 1.00
R9632:Fcgbpl1 UTSW 7 27,841,726 (GRCm39) missense probably benign
R9673:Fcgbpl1 UTSW 7 27,856,044 (GRCm39) missense probably benign 0.25
R9735:Fcgbpl1 UTSW 7 27,856,435 (GRCm39) missense probably damaging 1.00
Z1176:Fcgbpl1 UTSW 7 27,854,187 (GRCm39) missense probably benign 0.03
Z1176:Fcgbpl1 UTSW 7 27,841,811 (GRCm39) missense probably benign 0.06
Z1177:Fcgbpl1 UTSW 7 27,839,323 (GRCm39) missense probably benign 0.25
Z1186:Fcgbpl1 UTSW 7 27,856,411 (GRCm39) missense probably benign 0.01
Z1186:Fcgbpl1 UTSW 7 27,846,130 (GRCm39) missense probably benign 0.00
Z1186:Fcgbpl1 UTSW 7 27,830,997 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAATGAATGTCAGGGGTCC -3'
(R):5'- ATGAGCTGCAGACCAGACAG -3'

Sequencing Primer
(F):5'- GCTTCTGTGGACCTCTGGAC -3'
(R):5'- TGCAGACCAGACAGACACAG -3'
Posted On 2021-04-30