Incidental Mutation 'R8691:Naip2'
ID 668383
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene Name NLR family, apoptosis inhibitory protein 2
Synonyms Birc1b, Naip2, Naip-rs6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8691 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 100144063-100202092 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 100161168 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 787 (L787V)
Ref Sequence ENSEMBL: ENSMUSP00000070827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
AlphaFold Q9QUK4
Predicted Effect probably damaging
Transcript: ENSMUST00000067975
AA Change: L787V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: L787V

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117913
AA Change: L787V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: L787V

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167986
AA Change: L787V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: L787V

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G T 5: 30,105,289 A24E unknown Het
9530053A07Rik A T 7: 28,153,839 E1517V possibly damaging Het
Acap1 A G 11: 69,890,177 L117P probably damaging Het
Actl6b G A 5: 137,567,323 G394S probably damaging Het
Actr3b G T 5: 25,825,204 V177F possibly damaging Het
Adamts6 A G 13: 104,314,331 T341A probably benign Het
Agbl4 G T 4: 111,662,959 V474F probably benign Het
Bach1 T C 16: 87,719,629 S353P probably benign Het
C1qtnf9 G A 14: 60,779,692 D224N probably damaging Het
Camkmt A T 17: 85,113,832 N121Y probably damaging Het
Card6 A T 15: 5,099,596 Y773N possibly damaging Het
Cbfa2t2 C A 2: 154,500,483 P40T possibly damaging Het
Colec10 A C 15: 54,435,024 E60D probably benign Het
Cspg4 T C 9: 56,892,996 V1647A probably benign Het
Cyp2d34 A G 15: 82,618,270 F222L probably benign Het
Dennd1b A T 1: 139,042,036 I97F possibly damaging Het
Deptor A C 15: 55,220,200 D388A possibly damaging Het
Dhx40 T C 11: 86,799,593 K201E possibly damaging Het
Diexf T C 1: 193,113,802 E673G probably benign Het
Dnah6 G A 6: 73,168,867 R854C probably damaging Het
Dock9 T C 14: 121,640,105 I409V possibly damaging Het
Esp31 G T 17: 38,644,701 L78F possibly damaging Het
Fam214a A T 9: 75,010,053 T652S probably benign Het
Fam98c A T 7: 29,153,464 V48E probably damaging Het
Fgfr1 A T 8: 25,562,237 D193V possibly damaging Het
Furin C T 7: 80,392,027 probably benign Het
Gm17078 A T 14: 51,611,236 F15I probably damaging Het
Gm6803 T G 12: 88,018,508 K88N probably damaging Het
Grid2 G T 6: 63,503,337 R45L probably damaging Het
Hecw2 A G 1: 53,865,064 V1175A probably benign Het
Hspa1b T C 17: 34,957,096 I638V possibly damaging Het
Ighv6-7 A G 12: 114,455,684 V100A probably benign Het
Itch G T 2: 155,210,558 E693* probably null Het
Ivl G A 3: 92,571,516 S414L unknown Het
Kif5b T A 18: 6,225,787 N160I probably benign Het
Klhl5 A G 5: 65,149,538 probably benign Het
Lpin1 C T 12: 16,573,659 probably benign Het
Malsu1 C A 6: 49,075,237 H130Q probably benign Het
Nynrin C T 14: 55,872,649 R1738W probably damaging Het
Olfr1508 A T 14: 52,463,901 I36N possibly damaging Het
Olfr557 C T 7: 102,698,570 Q111* probably null Het
Olfr743 A G 14: 50,533,453 T14A probably benign Het
Olfr872 T A 9: 20,260,451 S204T probably benign Het
Pclo A G 5: 14,521,692 T364A unknown Het
Phlda2 A C 7: 143,502,469 S8A probably benign Het
Pou3f1 G A 4: 124,657,756 G17E unknown Het
Ppfibp2 A G 7: 107,747,578 D899G probably damaging Het
Pskh1 T C 8: 105,913,201 V171A probably damaging Het
Rictor A G 15: 6,787,032 T1262A probably damaging Het
Rnf41 T C 10: 128,438,208 V243A probably benign Het
Slc9c1 T A 16: 45,606,819 N1162K probably benign Het
Spef2 A T 15: 9,601,919 L1419* probably null Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnc A G 4: 63,962,076 C1954R probably damaging Het
Ttll11 T A 2: 35,784,149 I622F probably damaging Het
Vmn2r104 A G 17: 20,041,848 I340T probably damaging Het
Vmn2r110 G T 17: 20,583,142 D390E probably benign Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7342:Naip2 UTSW 13 100189356 missense probably benign 0.09
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
R7572:Naip2 UTSW 13 100154960 missense probably benign
R7699:Naip2 UTSW 13 100160369 missense probably benign 0.00
R7840:Naip2 UTSW 13 100144409 missense probably benign 0.14
R7874:Naip2 UTSW 13 100154951 missense probably benign 0.00
R7874:Naip2 UTSW 13 100154960 missense probably benign
R8038:Naip2 UTSW 13 100162062 missense probably benign 0.00
R8065:Naip2 UTSW 13 100189222 missense probably damaging 1.00
R8094:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8166:Naip2 UTSW 13 100162007 missense probably benign 0.03
R8378:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8669:Naip2 UTSW 13 100188969 missense probably benign 0.05
R8716:Naip2 UTSW 13 100144406 missense probably benign
R8720:Naip2 UTSW 13 100162122 missense probably benign 0.04
R8888:Naip2 UTSW 13 100189136 missense probably benign 0.01
R8895:Naip2 UTSW 13 100189136 missense probably benign 0.01
R9031:Naip2 UTSW 13 100178268 missense possibly damaging 0.55
R9072:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9072:Naip2 UTSW 13 100154960 missense probably benign
R9074:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9074:Naip2 UTSW 13 100154960 missense probably benign
R9077:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9077:Naip2 UTSW 13 100154960 missense probably benign
R9176:Naip2 UTSW 13 100162199 missense probably damaging 1.00
R9219:Naip2 UTSW 13 100160705 missense probably benign 0.06
R9358:Naip2 UTSW 13 100161572 missense probably damaging 1.00
R9371:Naip2 UTSW 13 100161846 nonsense probably null
R9414:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9415:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9416:Naip2 UTSW 13 100161735 missense probably damaging 1.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Z1176:Naip2 UTSW 13 100161593 missense probably benign 0.02
Z1176:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100152629 missense possibly damaging 0.65
Z1177:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100162865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAAATGAGATACAACTGTTGGCG -3'
(R):5'- AAAGGTGCAGCTAAGCCTCTC -3'

Sequencing Primer
(F):5'- GCGCTGCCTTTGATGAAG -3'
(R):5'- TCTCCAGGCCACAGTGTC -3'
Posted On 2021-04-30