Incidental Mutation 'R8691:Dock9'
ID668390
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Namededicator of cytokinesis 9
SynonymsD14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8691 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location121542046-121797837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121640105 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 409 (I409V)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040700
AA Change: I409V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: I409V

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: I411V

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: I411V

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212181
AA Change: I409V

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: I423V

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G T 5: 30,105,289 A24E unknown Het
9530053A07Rik A T 7: 28,153,839 E1517V possibly damaging Het
Acap1 A G 11: 69,890,177 L117P probably damaging Het
Actl6b G A 5: 137,567,323 G394S probably damaging Het
Actr3b G T 5: 25,825,204 V177F possibly damaging Het
Adamts6 A G 13: 104,314,331 T341A probably benign Het
Agbl4 G T 4: 111,662,959 V474F probably benign Het
Bach1 T C 16: 87,719,629 S353P probably benign Het
C1qtnf9 G A 14: 60,779,692 D224N probably damaging Het
Camkmt A T 17: 85,113,832 N121Y probably damaging Het
Card6 A T 15: 5,099,596 Y773N possibly damaging Het
Cbfa2t2 C A 2: 154,500,483 P40T possibly damaging Het
Colec10 A C 15: 54,435,024 E60D probably benign Het
Cspg4 T C 9: 56,892,996 V1647A probably benign Het
Cyp2d34 A G 15: 82,618,270 F222L probably benign Het
Dennd1b A T 1: 139,042,036 I97F possibly damaging Het
Deptor A C 15: 55,220,200 D388A possibly damaging Het
Dhx40 T C 11: 86,799,593 K201E possibly damaging Het
Diexf T C 1: 193,113,802 E673G probably benign Het
Dnah6 G A 6: 73,168,867 R854C probably damaging Het
Esp31 G T 17: 38,644,701 L78F possibly damaging Het
Fam214a A T 9: 75,010,053 T652S probably benign Het
Fam98c A T 7: 29,153,464 V48E probably damaging Het
Fgfr1 A T 8: 25,562,237 D193V possibly damaging Het
Furin C T 7: 80,392,027 probably benign Het
Gm17078 A T 14: 51,611,236 F15I probably damaging Het
Gm6803 T G 12: 88,018,508 K88N probably damaging Het
Grid2 G T 6: 63,503,337 R45L probably damaging Het
Hecw2 A G 1: 53,865,064 V1175A probably benign Het
Hspa1b T C 17: 34,957,096 I638V possibly damaging Het
Ighv6-7 A G 12: 114,455,684 V100A probably benign Het
Itch G T 2: 155,210,558 E693* probably null Het
Ivl G A 3: 92,571,516 S414L unknown Het
Kif5b T A 18: 6,225,787 N160I probably benign Het
Klhl5 A G 5: 65,149,538 probably benign Het
Lpin1 C T 12: 16,573,659 probably benign Het
Malsu1 C A 6: 49,075,237 H130Q probably benign Het
Naip2 A C 13: 100,161,168 L787V probably damaging Het
Nynrin C T 14: 55,872,649 R1738W probably damaging Het
Olfr1508 A T 14: 52,463,901 I36N possibly damaging Het
Olfr557 C T 7: 102,698,570 Q111* probably null Het
Olfr743 A G 14: 50,533,453 T14A probably benign Het
Olfr872 T A 9: 20,260,451 S204T probably benign Het
Pclo A G 5: 14,521,692 T364A unknown Het
Phlda2 A C 7: 143,502,469 S8A probably benign Het
Pou3f1 G A 4: 124,657,756 G17E unknown Het
Ppfibp2 A G 7: 107,747,578 D899G probably damaging Het
Pskh1 T C 8: 105,913,201 V171A probably damaging Het
Rictor A G 15: 6,787,032 T1262A probably damaging Het
Rnf41 T C 10: 128,438,208 V243A probably benign Het
Slc9c1 T A 16: 45,606,819 N1162K probably benign Het
Spef2 A T 15: 9,601,919 L1419* probably null Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnc A G 4: 63,962,076 C1954R probably damaging Het
Ttll11 T A 2: 35,784,149 I622F probably damaging Het
Vmn2r104 A G 17: 20,041,848 I340T probably damaging Het
Vmn2r110 G T 17: 20,583,142 D390E probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCACTGAGCGTGTTTAAC -3'
(R):5'- CTTTATAGCCTCAGTCTGTGTGAC -3'

Sequencing Primer
(F):5'- CTCACTGAGCGTGTTTAACATGTAAC -3'
(R):5'- GCATCATCTGTCCAAACTG -3'
Posted On2021-04-30