Incidental Mutation 'R8691:Slc9c1'
ID 668397
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 068545-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R8691 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45427182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1162 (N1162K)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023339] [ENSMUST00000159945] [ENSMUST00000161347]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000023339
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: N1162K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: N1162K

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161347
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G T 5: 30,310,287 (GRCm39) A24E unknown Het
Acap1 A G 11: 69,781,003 (GRCm39) L117P probably damaging Het
Actl6b G A 5: 137,565,585 (GRCm39) G394S probably damaging Het
Actr3b G T 5: 26,030,202 (GRCm39) V177F possibly damaging Het
Adamts6 A G 13: 104,450,839 (GRCm39) T341A probably benign Het
Agbl4 G T 4: 111,520,156 (GRCm39) V474F probably benign Het
Atosa A T 9: 74,917,335 (GRCm39) T652S probably benign Het
Bach1 T C 16: 87,516,517 (GRCm39) S353P probably benign Het
C1qtnf9 G A 14: 61,017,141 (GRCm39) D224N probably damaging Het
Camkmt A T 17: 85,421,260 (GRCm39) N121Y probably damaging Het
Card6 A T 15: 5,129,078 (GRCm39) Y773N possibly damaging Het
Cbfa2t2 C A 2: 154,342,403 (GRCm39) P40T possibly damaging Het
Colec10 A C 15: 54,298,420 (GRCm39) E60D probably benign Het
Cspg4 T C 9: 56,800,280 (GRCm39) V1647A probably benign Het
Cyp2d34 A G 15: 82,502,471 (GRCm39) F222L probably benign Het
Dennd1b A T 1: 138,969,774 (GRCm39) I97F possibly damaging Het
Deptor A C 15: 55,083,596 (GRCm39) D388A possibly damaging Het
Dhx40 T C 11: 86,690,419 (GRCm39) K201E possibly damaging Het
Dnah6 G A 6: 73,145,850 (GRCm39) R854C probably damaging Het
Dock9 T C 14: 121,877,517 (GRCm39) I409V possibly damaging Het
Eif1ad16 T G 12: 87,985,278 (GRCm39) K88N probably damaging Het
Esp31 G T 17: 38,955,592 (GRCm39) L78F possibly damaging Het
Fam98c A T 7: 28,852,889 (GRCm39) V48E probably damaging Het
Fcgbpl1 A T 7: 27,853,264 (GRCm39) E1517V possibly damaging Het
Fgfr1 A T 8: 26,052,253 (GRCm39) D193V possibly damaging Het
Furin C T 7: 80,041,775 (GRCm39) probably benign Het
Gm17078 A T 14: 51,848,693 (GRCm39) F15I probably damaging Het
Grid2 G T 6: 63,480,321 (GRCm39) R45L probably damaging Het
Hecw2 A G 1: 53,904,223 (GRCm39) V1175A probably benign Het
Hspa1b T C 17: 35,176,072 (GRCm39) I638V possibly damaging Het
Ighv6-7 A G 12: 114,419,304 (GRCm39) V100A probably benign Het
Itch G T 2: 155,052,478 (GRCm39) E693* probably null Het
Ivl G A 3: 92,478,823 (GRCm39) S414L unknown Het
Kif5b T A 18: 6,225,787 (GRCm39) N160I probably benign Het
Klhl5 A G 5: 65,306,881 (GRCm39) probably benign Het
Lpin1 C T 12: 16,623,660 (GRCm39) probably benign Het
Malsu1 C A 6: 49,052,171 (GRCm39) H130Q probably benign Het
Naip2 A C 13: 100,297,676 (GRCm39) L787V probably damaging Het
Nynrin C T 14: 56,110,106 (GRCm39) R1738W probably damaging Het
Or11g27 A G 14: 50,770,910 (GRCm39) T14A probably benign Het
Or4e1 A T 14: 52,701,358 (GRCm39) I36N possibly damaging Het
Or51d1 C T 7: 102,347,777 (GRCm39) Q111* probably null Het
Or7e176 T A 9: 20,171,747 (GRCm39) S204T probably benign Het
Pclo A G 5: 14,571,706 (GRCm39) T364A unknown Het
Phlda2 A C 7: 143,056,206 (GRCm39) S8A probably benign Het
Pou3f1 G A 4: 124,551,549 (GRCm39) G17E unknown Het
Ppfibp2 A G 7: 107,346,785 (GRCm39) D899G probably damaging Het
Pskh1 T C 8: 106,639,833 (GRCm39) V171A probably damaging Het
Rictor A G 15: 6,816,513 (GRCm39) T1262A probably damaging Het
Rnf41 T C 10: 128,274,077 (GRCm39) V243A probably benign Het
Spef2 A T 15: 9,602,005 (GRCm39) L1419* probably null Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tnc A G 4: 63,880,313 (GRCm39) C1954R probably damaging Het
Ttll11 T A 2: 35,674,161 (GRCm39) I622F probably damaging Het
Utp25 T C 1: 192,796,110 (GRCm39) E673G probably benign Het
Vmn2r104 A G 17: 20,262,110 (GRCm39) I340T probably damaging Het
Vmn2r110 G T 17: 20,803,404 (GRCm39) D390E probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCTGTGTCAGGTCCCACAC -3'
(R):5'- ATAACATCATTTGGAGAGTTGGTTG -3'

Sequencing Primer
(F):5'- CTGTTGTTGCGACAGACTACAAC -3'
(R):5'- GGTTAGTGTGAGATGCTTTAATTCAC -3'
Posted On 2021-04-30