Incidental Mutation 'R8691:Slc9c1'
ID668397
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R8691 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45606819 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1162 (N1162K)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023339] [ENSMUST00000159945] [ENSMUST00000161347]
Predicted Effect probably benign
Transcript: ENSMUST00000023339
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: N1162K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: N1162K

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161347
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G T 5: 30,105,289 A24E unknown Het
9530053A07Rik A T 7: 28,153,839 E1517V possibly damaging Het
Acap1 A G 11: 69,890,177 L117P probably damaging Het
Actl6b G A 5: 137,567,323 G394S probably damaging Het
Actr3b G T 5: 25,825,204 V177F possibly damaging Het
Adamts6 A G 13: 104,314,331 T341A probably benign Het
Agbl4 G T 4: 111,662,959 V474F probably benign Het
Bach1 T C 16: 87,719,629 S353P probably benign Het
C1qtnf9 G A 14: 60,779,692 D224N probably damaging Het
Camkmt A T 17: 85,113,832 N121Y probably damaging Het
Card6 A T 15: 5,099,596 Y773N possibly damaging Het
Cbfa2t2 C A 2: 154,500,483 P40T possibly damaging Het
Colec10 A C 15: 54,435,024 E60D probably benign Het
Cspg4 T C 9: 56,892,996 V1647A probably benign Het
Cyp2d34 A G 15: 82,618,270 F222L probably benign Het
Dennd1b A T 1: 139,042,036 I97F possibly damaging Het
Deptor A C 15: 55,220,200 D388A possibly damaging Het
Dhx40 T C 11: 86,799,593 K201E possibly damaging Het
Diexf T C 1: 193,113,802 E673G probably benign Het
Dnah6 G A 6: 73,168,867 R854C probably damaging Het
Dock9 T C 14: 121,640,105 I409V possibly damaging Het
Esp31 G T 17: 38,644,701 L78F possibly damaging Het
Fam214a A T 9: 75,010,053 T652S probably benign Het
Fam98c A T 7: 29,153,464 V48E probably damaging Het
Fgfr1 A T 8: 25,562,237 D193V possibly damaging Het
Furin C T 7: 80,392,027 probably benign Het
Gm17078 A T 14: 51,611,236 F15I probably damaging Het
Gm6803 T G 12: 88,018,508 K88N probably damaging Het
Grid2 G T 6: 63,503,337 R45L probably damaging Het
Hecw2 A G 1: 53,865,064 V1175A probably benign Het
Hspa1b T C 17: 34,957,096 I638V possibly damaging Het
Ighv6-7 A G 12: 114,455,684 V100A probably benign Het
Itch G T 2: 155,210,558 E693* probably null Het
Ivl G A 3: 92,571,516 S414L unknown Het
Kif5b T A 18: 6,225,787 N160I probably benign Het
Klhl5 A G 5: 65,149,538 probably benign Het
Lpin1 C T 12: 16,573,659 probably benign Het
Malsu1 C A 6: 49,075,237 H130Q probably benign Het
Naip2 A C 13: 100,161,168 L787V probably damaging Het
Nynrin C T 14: 55,872,649 R1738W probably damaging Het
Olfr1508 A T 14: 52,463,901 I36N possibly damaging Het
Olfr557 C T 7: 102,698,570 Q111* probably null Het
Olfr743 A G 14: 50,533,453 T14A probably benign Het
Olfr872 T A 9: 20,260,451 S204T probably benign Het
Pclo A G 5: 14,521,692 T364A unknown Het
Phlda2 A C 7: 143,502,469 S8A probably benign Het
Pou3f1 G A 4: 124,657,756 G17E unknown Het
Ppfibp2 A G 7: 107,747,578 D899G probably damaging Het
Pskh1 T C 8: 105,913,201 V171A probably damaging Het
Rictor A G 15: 6,787,032 T1262A probably damaging Het
Rnf41 T C 10: 128,438,208 V243A probably benign Het
Spef2 A T 15: 9,601,919 L1419* probably null Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnc A G 4: 63,962,076 C1954R probably damaging Het
Ttll11 T A 2: 35,784,149 I622F probably damaging Het
Vmn2r104 A G 17: 20,041,848 I340T probably damaging Het
Vmn2r110 G T 17: 20,583,142 D390E probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCTGTGTCAGGTCCCACAC -3'
(R):5'- ATAACATCATTTGGAGAGTTGGTTG -3'

Sequencing Primer
(F):5'- CTGTTGTTGCGACAGACTACAAC -3'
(R):5'- GGTTAGTGTGAGATGCTTTAATTCAC -3'
Posted On2021-04-30