Mutagenetix > Incidental Mutation

Incidental Mutation 'R8691:Vmn2r104'

668399

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

068545-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R8691 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20041848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 340 (I340T)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

AlphaFold

E9Q2J5

Predicted Effect

probably damaging
Transcript: ENSMUST00000168050
AA Change: I340T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: I340T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082J24Rik	G	T	5: 30,105,289	A24E	unknown	Het
9530053A07Rik	A	T	7: 28,153,839	E1517V	possibly damaging	Het
Acap1	A	G	11: 69,890,177	L117P	probably damaging	Het
Actl6b	G	A	5: 137,567,323	G394S	probably damaging	Het
Actr3b	G	T	5: 25,825,204	V177F	possibly damaging	Het
Adamts6	A	G	13: 104,314,331	T341A	probably benign	Het
Agbl4	G	T	4: 111,662,959	V474F	probably benign	Het
Bach1	T	C	16: 87,719,629	S353P	probably benign	Het
C1qtnf9	G	A	14: 60,779,692	D224N	probably damaging	Het
Camkmt	A	T	17: 85,113,832	N121Y	probably damaging	Het
Card6	A	T	15: 5,099,596	Y773N	possibly damaging	Het
Cbfa2t2	C	A	2: 154,500,483	P40T	possibly damaging	Het
Colec10	A	C	15: 54,435,024	E60D	probably benign	Het
Cspg4	T	C	9: 56,892,996	V1647A	probably benign	Het
Cyp2d34	A	G	15: 82,618,270	F222L	probably benign	Het
Dennd1b	A	T	1: 139,042,036	I97F	possibly damaging	Het
Deptor	A	C	15: 55,220,200	D388A	possibly damaging	Het
Dhx40	T	C	11: 86,799,593	K201E	possibly damaging	Het
Diexf	T	C	1: 193,113,802	E673G	probably benign	Het
Dnah6	G	A	6: 73,168,867	R854C	probably damaging	Het
Dock9	T	C	14: 121,640,105	I409V	possibly damaging	Het
Esp31	G	T	17: 38,644,701	L78F	possibly damaging	Het
Fam214a	A	T	9: 75,010,053	T652S	probably benign	Het
Fam98c	A	T	7: 29,153,464	V48E	probably damaging	Het
Fgfr1	A	T	8: 25,562,237	D193V	possibly damaging	Het
Furin	C	T	7: 80,392,027		probably benign	Het
Gm17078	A	T	14: 51,611,236	F15I	probably damaging	Het
Gm6803	T	G	12: 88,018,508	K88N	probably damaging	Het
Grid2	G	T	6: 63,503,337	R45L	probably damaging	Het
Hecw2	A	G	1: 53,865,064	V1175A	probably benign	Het
Hspa1b	T	C	17: 34,957,096	I638V	possibly damaging	Het
Ighv6-7	A	G	12: 114,455,684	V100A	probably benign	Het
Itch	G	T	2: 155,210,558	E693*	probably null	Het
Ivl	G	A	3: 92,571,516	S414L	unknown	Het
Kif5b	T	A	18: 6,225,787	N160I	probably benign	Het
Klhl5	A	G	5: 65,149,538		probably benign	Het
Lpin1	C	T	12: 16,573,659		probably benign	Het
Malsu1	C	A	6: 49,075,237	H130Q	probably benign	Het
Naip2	A	C	13: 100,161,168	L787V	probably damaging	Het
Nynrin	C	T	14: 55,872,649	R1738W	probably damaging	Het
Olfr1508	A	T	14: 52,463,901	I36N	possibly damaging	Het
Olfr557	C	T	7: 102,698,570	Q111*	probably null	Het
Olfr743	A	G	14: 50,533,453	T14A	probably benign	Het
Olfr872	T	A	9: 20,260,451	S204T	probably benign	Het
Pclo	A	G	5: 14,521,692	T364A	unknown	Het
Phlda2	A	C	7: 143,502,469	S8A	probably benign	Het
Pou3f1	G	A	4: 124,657,756	G17E	unknown	Het
Ppfibp2	A	G	7: 107,747,578	D899G	probably damaging	Het
Pskh1	T	C	8: 105,913,201	V171A	probably damaging	Het
Rictor	A	G	15: 6,787,032	T1262A	probably damaging	Het
Rnf41	T	C	10: 128,438,208	V243A	probably benign	Het
Slc9c1	T	A	16: 45,606,819	N1162K	probably benign	Het
Spef2	A	T	15: 9,601,919	L1419*	probably null	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tnc	A	G	4: 63,962,076	C1954R	probably damaging	Het
Ttll11	T	A	2: 35,784,149	I622F	probably damaging	Het
Vmn2r110	G	T	17: 20,583,142	D390E	probably benign	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
R8795:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8900:Vmn2r104	UTSW	17	20041662	missense	probably damaging	0.99
R8913:Vmn2r104	UTSW	17	20029706	missense	probably damaging	1.00
R9180:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9199:Vmn2r104	UTSW	17	20041835	missense	probably damaging	0.99
R9282:Vmn2r104	UTSW	17	20040836	missense	probably damaging	1.00
R9303:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9305:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9322:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9325:Vmn2r104	UTSW	17	20048171	missense	possibly damaging	0.95
R9414:Vmn2r104	UTSW	17	20029988	missense	probably damaging	0.99
R9785:Vmn2r104	UTSW	17	20048147	missense	probably benign
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCCAGAGCATATACACCATTG -3'
(R):5'- ATGATCCCAGCCACATGGAC -3'

Sequencing Primer
(F):5'- CACCATTGTAAATGTTTGTGCTC -3'
(R):5'- GCCACATGGACCTCATATTTTACTAG -3'

Posted On

2021-04-30