Incidental Mutation 'R8692:Pkhd1'
ID 668405
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
MMRRC Submission 068546-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R8692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 20128003-20688288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20462374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 2060 (L2060Q)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000088448
AA Change: L2060Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: L2060Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,327,874 (GRCm39) I1402S probably damaging Het
Abca9 T C 11: 110,032,409 (GRCm39) D736G probably benign Het
Acy1 T C 9: 106,310,377 (GRCm39) E377G probably damaging Het
Apob G A 12: 8,058,270 (GRCm39) V2251M probably damaging Het
Arhgap23 C A 11: 97,345,322 (GRCm39) T657K probably damaging Het
Cabin1 T C 10: 75,587,410 (GRCm39) K129R probably benign Het
Cdh24 A T 14: 54,875,793 (GRCm39) F259I probably benign Het
Cops6 A G 5: 138,162,083 (GRCm39) N307S probably benign Het
Cyp4a31 G A 4: 115,423,769 (GRCm39) V143M probably damaging Het
Deaf1 A T 7: 140,877,444 (GRCm39) I561K probably benign Het
Dnah7a A C 1: 53,472,175 (GRCm39) S3531A probably benign Het
Dnajc14 T A 10: 128,642,900 (GRCm39) I274N probably damaging Het
Dnmt1 A G 9: 20,853,077 (GRCm39) L48S probably damaging Het
Efna4 A T 3: 89,242,549 (GRCm39) I115N probably damaging Het
Ermp1 T A 19: 29,594,093 (GRCm39) L692F probably benign Het
Fcho2 GT G 13: 98,882,382 (GRCm39) probably null Het
Fcsk A T 8: 111,615,722 (GRCm39) C536S probably benign Het
Fermt2 A T 14: 45,742,099 (GRCm39) C82* probably null Het
Gabra6 G T 11: 42,210,537 (GRCm39) D61E probably damaging Het
Gdpd4 T A 7: 97,690,140 (GRCm39) S611T probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,497,379 (GRCm39) probably benign Het
Gm17430 G A 18: 9,726,336 (GRCm39) A112V probably benign Het
Gm2381 A T 7: 42,472,071 (GRCm39) L2Q probably damaging Het
Hif3a A T 7: 16,788,701 (GRCm39) L90Q probably benign Het
Irf3 C T 7: 44,649,889 (GRCm39) Q168* probably null Het
Krt82 T G 15: 101,456,828 (GRCm39) D184A possibly damaging Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lrrc49 A G 9: 60,594,445 (GRCm39) S28P probably damaging Het
Mfsd11 T A 11: 116,752,443 (GRCm39) N197K probably benign Het
Mindy1 A G 3: 95,199,587 (GRCm39) D243G probably damaging Het
Mphosph9 A T 5: 124,450,875 (GRCm39) W299R probably damaging Het
Mst1r G T 9: 107,792,050 (GRCm39) R862L possibly damaging Het
Nasp T A 4: 116,469,280 (GRCm39) probably null Het
Ncapg2 T C 12: 116,414,049 (GRCm39) I1073T probably damaging Het
Nek2 A T 1: 191,554,745 (GRCm39) K152N probably benign Het
Neurod2 T C 11: 98,218,960 (GRCm39) E68G probably benign Het
Or1j4 A T 2: 36,740,096 (GRCm39) I13F probably benign Het
Or2w3b T C 11: 58,623,595 (GRCm39) Y132C probably damaging Het
P4ha3 T A 7: 99,955,228 (GRCm39) I361N probably damaging Het
Pcdh15 T A 10: 74,289,805 (GRCm39) S875T possibly damaging Het
Pde7b G T 10: 20,423,639 (GRCm39) P79Q probably benign Het
Phb2 G A 6: 124,692,097 (GRCm39) A228T probably damaging Het
Piezo2 A T 18: 63,225,971 (GRCm39) C888* probably null Het
Pms1 T C 1: 53,246,052 (GRCm39) M496V probably benign Het
Ppfibp1 C T 6: 146,892,013 (GRCm39) T91I probably benign Het
Ppp1r9b T C 11: 94,891,077 (GRCm39) L557P probably damaging Het
Ppp2r5c G T 12: 110,489,032 (GRCm39) V68L probably benign Het
Qrfp T A 2: 31,698,797 (GRCm39) H45L probably benign Het
Rasgrp1 G A 2: 117,115,353 (GRCm39) T745I probably damaging Het
Rnf144a G A 12: 26,370,972 (GRCm39) T163I probably benign Het
Sbsn A T 7: 30,451,522 (GRCm39) H179L unknown Het
Simc1 G A 13: 54,673,193 (GRCm39) V514I probably benign Het
Slc35d1 A G 4: 103,047,051 (GRCm39) M249T Het
Slfn4 T A 11: 83,079,709 (GRCm39) H466Q possibly damaging Het
Stab2 A T 10: 86,808,794 (GRCm39) C172S probably damaging Het
Tanc1 T C 2: 59,673,989 (GRCm39) I1698T probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tiam2 A C 17: 3,479,082 (GRCm39) D605A probably damaging Het
Tmed4 A T 11: 6,223,822 (GRCm39) D151E probably benign Het
Trim62 A T 4: 128,794,465 (GRCm39) I211F possibly damaging Het
Ttpa A G 4: 20,008,585 (GRCm39) D49G probably benign Het
Usf3 T C 16: 44,040,103 (GRCm39) S1528P probably benign Het
Usp34 C T 11: 23,379,325 (GRCm39) T1991I Het
Vash1 G A 12: 86,735,863 (GRCm39) V250M possibly damaging Het
Vmn1r199 T C 13: 22,567,809 (GRCm39) *368Q probably null Het
Vmn1r74 A G 7: 11,580,972 (GRCm39) T91A probably benign Het
Vmn1r8 T C 6: 57,013,557 (GRCm39) F203L probably benign Het
Vmn2r13 G T 5: 109,319,514 (GRCm39) Q489K probably benign Het
Vmn2r-ps158 G T 7: 42,697,108 (GRCm39) A722S probably benign Het
Zfp385b A T 2: 77,549,971 (GRCm39) V38E probably damaging Het
Zfp820 A G 17: 22,037,876 (GRCm39) I484T probably benign Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20,637,098 (GRCm39) critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20,594,294 (GRCm39) missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20,151,408 (GRCm39) critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20,641,614 (GRCm39) missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20,187,971 (GRCm39) missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20,593,482 (GRCm39) missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20,279,400 (GRCm39) missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20,604,754 (GRCm39) splice site probably benign
IGL01313:Pkhd1 APN 1 20,271,248 (GRCm39) missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20,593,201 (GRCm39) missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20,619,939 (GRCm39) missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20,269,683 (GRCm39) missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20,629,643 (GRCm39) critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20,187,203 (GRCm39) missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20,604,857 (GRCm39) nonsense probably null
IGL01790:Pkhd1 APN 1 20,628,895 (GRCm39) missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20,429,134 (GRCm39) missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20,173,459 (GRCm39) missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20,290,307 (GRCm39) missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20,268,361 (GRCm39) missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20,593,791 (GRCm39) missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20,592,971 (GRCm39) missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20,271,451 (GRCm39) missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20,447,623 (GRCm39) missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20,187,419 (GRCm39) missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20,345,839 (GRCm39) missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20,654,325 (GRCm39) missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20,279,484 (GRCm39) missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20,140,600 (GRCm39) critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20,271,007 (GRCm39) missense probably benign
IGL02389:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20,269,710 (GRCm39) missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20,632,642 (GRCm39) missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20,484,645 (GRCm39) missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20,592,983 (GRCm39) missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20,434,425 (GRCm39) missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20,462,389 (GRCm39) missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20,143,731 (GRCm39) missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20,380,934 (GRCm39) missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20,590,480 (GRCm39) missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20,621,126 (GRCm39) missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20,628,976 (GRCm39) missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20,290,253 (GRCm39) splice site probably benign
IGL02752:Pkhd1 APN 1 20,623,815 (GRCm39) missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20,431,235 (GRCm39) missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20,678,640 (GRCm39) nonsense probably null
IGL02960:Pkhd1 APN 1 20,447,670 (GRCm39) missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20,593,187 (GRCm39) missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20,592,923 (GRCm39) missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20,635,857 (GRCm39) missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20,268,395 (GRCm39) missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20,271,243 (GRCm39) missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20,151,524 (GRCm39) splice site probably benign
IGL03375:Pkhd1 APN 1 20,187,247 (GRCm39) missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20,270,894 (GRCm39) missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20,593,118 (GRCm39) missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20,607,589 (GRCm39) missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20,681,638 (GRCm39) intron probably benign
P0035:Pkhd1 UTSW 1 20,187,571 (GRCm39) missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20,293,130 (GRCm39) missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0115:Pkhd1 UTSW 1 20,420,714 (GRCm39) missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20,429,141 (GRCm39) missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20,610,624 (GRCm39) missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20,620,046 (GRCm39) splice site probably null
R0323:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20,451,771 (GRCm39) missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20,188,012 (GRCm39) missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20,629,693 (GRCm39) missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20,380,738 (GRCm39) splice site probably benign
R0550:Pkhd1 UTSW 1 20,417,447 (GRCm39) missense probably null 1.00
R0584:Pkhd1 UTSW 1 20,309,660 (GRCm39) nonsense probably null
R0586:Pkhd1 UTSW 1 20,594,335 (GRCm39) missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20,271,114 (GRCm39) missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20,187,397 (GRCm39) missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20,187,698 (GRCm39) missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20,594,454 (GRCm39) missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20,268,331 (GRCm39) missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20,187,708 (GRCm39) missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20,420,745 (GRCm39) missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20,269,605 (GRCm39) missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20,271,483 (GRCm39) missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20,187,950 (GRCm39) missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20,593,053 (GRCm39) missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20,637,680 (GRCm39) missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20,641,629 (GRCm39) missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20,625,447 (GRCm39) splice site probably benign
R1411:Pkhd1 UTSW 1 20,444,120 (GRCm39) missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20,604,782 (GRCm39) missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20,593,207 (GRCm39) missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20,187,625 (GRCm39) missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20,417,664 (GRCm39) missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20,188,049 (GRCm39) missense probably benign
R1617:Pkhd1 UTSW 1 20,268,274 (GRCm39) missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20,593,121 (GRCm39) missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20,654,353 (GRCm39) missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20,621,064 (GRCm39) splice site probably benign
R1753:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20,635,935 (GRCm39) missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20,655,376 (GRCm39) splice site probably benign
R1822:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20,187,293 (GRCm39) missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20,685,491 (GRCm39) critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20,636,980 (GRCm39) critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20,151,524 (GRCm39) splice site probably benign
R1969:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20,187,284 (GRCm39) missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20,269,683 (GRCm39) missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20,270,893 (GRCm39) missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20,683,036 (GRCm39) missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20,271,559 (GRCm39) missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20,623,798 (GRCm39) nonsense probably null
R2142:Pkhd1 UTSW 1 20,594,119 (GRCm39) missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20,484,444 (GRCm39) critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20,623,741 (GRCm39) missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20,607,584 (GRCm39) missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20,635,863 (GRCm39) missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20,604,759 (GRCm39) critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20,271,073 (GRCm39) missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20,271,079 (GRCm39) missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20,271,389 (GRCm39) missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20,279,406 (GRCm39) missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20,293,185 (GRCm39) missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20,174,823 (GRCm39) missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20,625,353 (GRCm39) missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20,655,879 (GRCm39) missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20,128,524 (GRCm39) makesense probably null
R3838:Pkhd1 UTSW 1 20,604,853 (GRCm39) missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20,628,947 (GRCm39) missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20,271,151 (GRCm39) missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20,382,362 (GRCm39) nonsense probably null
R3926:Pkhd1 UTSW 1 20,621,097 (GRCm39) missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20,633,910 (GRCm39) missense probably benign 0.06
R4184:Pkhd1 UTSW 1 20,279,501 (GRCm39) missense probably benign 0.03
R4255:Pkhd1 UTSW 1 20,664,158 (GRCm39) missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20,128,608 (GRCm39) missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20,128,841 (GRCm39) missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20,484,516 (GRCm39) missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20,309,635 (GRCm39) missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20,593,538 (GRCm39) missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20,282,082 (GRCm39) missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20,604,943 (GRCm39) missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20,683,633 (GRCm39) missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20,271,092 (GRCm39) missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20,573,280 (GRCm39) missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20,434,391 (GRCm39) missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20,151,452 (GRCm39) missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20,594,354 (GRCm39) missense probably benign
R4750:Pkhd1 UTSW 1 20,594,336 (GRCm39) missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20,269,639 (GRCm39) missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20,607,625 (GRCm39) missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20,140,712 (GRCm39) missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20,279,450 (GRCm39) missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20,358,429 (GRCm39) missense probably null 0.01
R5062:Pkhd1 UTSW 1 20,655,935 (GRCm39) missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20,655,415 (GRCm39) missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20,279,448 (GRCm39) missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20,617,565 (GRCm39) missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20,345,865 (GRCm39) missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20,604,769 (GRCm39) missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20,420,635 (GRCm39) critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20,636,094 (GRCm39) missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20,520,528 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20,593,658 (GRCm39) missense probably damaging 0.96
R5346:Pkhd1 UTSW 1 20,462,321 (GRCm39) missense probably benign
R5431:Pkhd1 UTSW 1 20,188,060 (GRCm39) missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20,309,609 (GRCm39) missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20,271,380 (GRCm39) missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20,447,628 (GRCm39) missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20,151,476 (GRCm39) missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20,593,366 (GRCm39) missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20,143,750 (GRCm39) missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20,628,850 (GRCm39) missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20,658,755 (GRCm39) missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20,617,685 (GRCm39) missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20,593,875 (GRCm39) nonsense probably null
R5760:Pkhd1 UTSW 1 20,143,778 (GRCm39) missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20,279,409 (GRCm39) missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20,128,824 (GRCm39) missense probably benign
R5810:Pkhd1 UTSW 1 20,270,897 (GRCm39) missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20,269,629 (GRCm39) missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20,128,902 (GRCm39) missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20,271,307 (GRCm39) missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20,451,685 (GRCm39) missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20,444,960 (GRCm39) nonsense probably null
R5852:Pkhd1 UTSW 1 20,447,632 (GRCm39) missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20,590,434 (GRCm39) missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20,593,994 (GRCm39) missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20,282,175 (GRCm39) missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20,655,927 (GRCm39) missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20,271,047 (GRCm39) missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20,682,929 (GRCm39) missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20,128,563 (GRCm39) missense probably benign
R6886:Pkhd1 UTSW 1 20,417,504 (GRCm39) missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20,593,739 (GRCm39) missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20,604,925 (GRCm39) missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20,632,675 (GRCm39) missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20,628,943 (GRCm39) missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20,593,350 (GRCm39) missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20,617,743 (GRCm39) missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20,664,177 (GRCm39) missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20,271,197 (GRCm39) missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20,309,528 (GRCm39) missense not run
R7436:Pkhd1 UTSW 1 20,270,925 (GRCm39) missense probably benign
R7473:Pkhd1 UTSW 1 20,619,980 (GRCm39) missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20,417,585 (GRCm39) missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20,271,149 (GRCm39) missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20,617,717 (GRCm39) missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20,632,639 (GRCm39) missense probably damaging 1.00
R7832:Pkhd1 UTSW 1 20,573,223 (GRCm39) missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20,382,273 (GRCm39) missense probably benign
R7920:Pkhd1 UTSW 1 20,345,759 (GRCm39) missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20,579,115 (GRCm39) critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20,451,662 (GRCm39) missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20,683,639 (GRCm39) missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20,593,313 (GRCm39) missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20,632,682 (GRCm39) missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20,607,644 (GRCm39) splice site probably benign
R8485:Pkhd1 UTSW 1 20,593,257 (GRCm39) missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20,590,432 (GRCm39) missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20,593,199 (GRCm39) missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20,358,461 (GRCm39) missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20,143,679 (GRCm39) critical splice donor site probably null
R8907:Pkhd1 UTSW 1 20,187,785 (GRCm39) missense possibly damaging 0.88
R8934:Pkhd1 UTSW 1 20,462,234 (GRCm39) critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20,417,529 (GRCm39) missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20,434,425 (GRCm39) missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20,592,975 (GRCm39) missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20,573,176 (GRCm39) missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20,632,586 (GRCm39) missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20,604,799 (GRCm39) missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20,444,174 (GRCm39) missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20,618,351 (GRCm39) missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20,293,118 (GRCm39) missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20,682,953 (GRCm39) missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20,637,741 (GRCm39) missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20,269,570 (GRCm39) missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20,462,437 (GRCm39) missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20,617,690 (GRCm39) missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20,420,708 (GRCm39) missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20,484,636 (GRCm39) missense probably benign
R9781:Pkhd1 UTSW 1 20,187,665 (GRCm39) missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20,637,073 (GRCm39) missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20,444,150 (GRCm39) missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20,590,450 (GRCm39) missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20,593,971 (GRCm39) missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20,593,845 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,380,818 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,188,107 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,621,243 (GRCm39) missense probably benign
Z1177:Pkhd1 UTSW 1 20,594,162 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCATGTAAACCTATCCAAGCTG -3'
(R):5'- CTCGATGTCATGTCAAGACTACC -3'

Sequencing Primer
(F):5'- TCCAAGCTGAAGTCTGAGTAC -3'
(R):5'- AATTTTGTCTAGTGGCAATACCTGTG -3'
Posted On 2021-04-30