Incidental Mutation 'R8692:Olfr350'
ID 668411
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
MMRRC Submission
Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R8692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36850084 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 13 (I13F)
Ref Sequence ENSEMBL: ENSMUSP00000150158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect probably benign
Transcript: ENSMUST00000055130
AA Change: I13F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: I13F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214457
AA Change: I13F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215100
AA Change: I13F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,288,715 I1402S probably damaging Het
Abca9 T C 11: 110,141,583 D736G probably benign Het
Acy1 T C 9: 106,433,178 E377G probably damaging Het
Apob G A 12: 8,008,270 V2251M probably damaging Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Cabin1 T C 10: 75,751,576 K129R probably benign Het
Cdh24 A T 14: 54,638,336 F259I probably benign Het
Cops6 A G 5: 138,163,821 N307S probably benign Het
Cyp4a31 G A 4: 115,566,572 V143M probably damaging Het
Deaf1 A T 7: 141,297,531 I561K probably benign Het
Dnah7a A C 1: 53,433,016 S3531A probably benign Het
Dnajc14 T A 10: 128,807,031 I274N probably damaging Het
Dnmt1 A G 9: 20,941,781 L48S probably damaging Het
Efna4 A T 3: 89,335,242 I115N probably damaging Het
Ermp1 T A 19: 29,616,693 L692F probably benign Het
Fcho2 GT G 13: 98,745,874 probably null Het
Fermt2 A T 14: 45,504,642 C82* probably null Het
Fuk A T 8: 110,889,090 C536S probably benign Het
Gabra6 G T 11: 42,319,710 D61E probably damaging Het
Gdpd4 T A 7: 98,040,933 S611T probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm17430 G A 18: 9,726,336 A112V probably benign Het
Gm2381 A T 7: 42,822,647 L2Q probably damaging Het
Gm9268 G T 7: 43,047,684 A722S probably benign Het
Hif3a A T 7: 17,054,776 L90Q probably benign Het
Irf3 C T 7: 45,000,465 Q168* probably null Het
Krt82 T G 15: 101,548,393 D184A possibly damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrrc49 A G 9: 60,687,162 S28P probably damaging Het
Mfsd11 T A 11: 116,861,617 N197K probably benign Het
Mindy1 A G 3: 95,292,276 D243G probably damaging Het
Mphosph9 A T 5: 124,312,812 W299R probably damaging Het
Mst1r G T 9: 107,914,851 R862L possibly damaging Het
Nasp T A 4: 116,612,083 probably null Het
Ncapg2 T C 12: 116,450,429 I1073T probably damaging Het
Nek2 A T 1: 191,822,633 K152N probably benign Het
Neurod2 T C 11: 98,328,134 E68G probably benign Het
Olfr317 T C 11: 58,732,769 Y132C probably damaging Het
P4ha3 T A 7: 100,306,021 I361N probably damaging Het
Pcdh15 T A 10: 74,453,973 S875T possibly damaging Het
Pde7b G T 10: 20,547,893 P79Q probably benign Het
Phb2 G A 6: 124,715,134 A228T probably damaging Het
Piezo2 A T 18: 63,092,900 C888* probably null Het
Pkhd1 A T 1: 20,392,150 L2060Q probably damaging Het
Pms1 T C 1: 53,206,893 M496V probably benign Het
Ppfibp1 C T 6: 146,990,515 T91I probably benign Het
Ppp1r9b T C 11: 95,000,251 L557P probably damaging Het
Ppp2r5c G T 12: 110,522,598 V68L probably benign Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rasgrp1 G A 2: 117,284,872 T745I probably damaging Het
Rnf144a G A 12: 26,320,973 T163I probably benign Het
Sbsn A T 7: 30,752,097 H179L unknown Het
Simc1 G A 13: 54,525,380 V514I probably benign Het
Slc35d1 A G 4: 103,189,854 M249T Het
Slfn4 T A 11: 83,188,883 H466Q possibly damaging Het
Stab2 A T 10: 86,972,930 C172S probably damaging Het
Tanc1 T C 2: 59,843,645 I1698T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tiam2 A C 17: 3,428,807 D605A probably damaging Het
Tmed4 A T 11: 6,273,822 D151E probably benign Het
Trim62 A T 4: 128,900,672 I211F possibly damaging Het
Ttpa A G 4: 20,008,585 D49G probably benign Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Usp34 C T 11: 23,429,325 T1991I Het
Vash1 G A 12: 86,689,089 V250M possibly damaging Het
Vmn1r199 T C 13: 22,383,639 *368Q probably null Het
Vmn1r74 A G 7: 11,847,045 T91A probably benign Het
Vmn1r8 T C 6: 57,036,572 F203L probably benign Het
Vmn2r13 G T 5: 109,171,648 Q489K probably benign Het
Zfp385b A T 2: 77,719,627 V38E probably damaging Het
Zfp820 A G 17: 21,818,895 I484T probably benign Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0557:Olfr350 UTSW 2 36850748 missense possibly damaging 0.95
R0665:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2107:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5134:Olfr350 UTSW 2 36850476 missense probably benign 0.03
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7258:Olfr350 UTSW 2 36850340 missense probably damaging 0.99
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8346:Olfr350 UTSW 2 36850339 missense probably benign 0.02
R9120:Olfr350 UTSW 2 36850131 nonsense probably null
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCATTTCAGGTGCAACCC -3'
(R):5'- ATCTTGGGTACAGTGACAGATG -3'

Sequencing Primer
(F):5'- GTGCAACCCACTTTAAATGGCTG -3'
(R):5'- AAAGAGATGTCTGTGAAGGCC -3'
Posted On 2021-04-30