Incidental Mutation 'R8692:Mindy1'
ID668417
Institutional Source Beutler Lab
Gene Symbol Mindy1
Ensembl Gene ENSMUSG00000038712
Gene NameMINDY lysine 48 deubiquitinase 1
Synonyms4930504E06Rik, cI-40, NF-E2 inducible protein, 1810005H09Rik, Fam63a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8692 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95281345-95296166 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95292276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 243 (D243G)
Ref Sequence ENSEMBL: ENSMUSP00000102805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000039537] [ENSMUST00000107183] [ENSMUST00000107187] [ENSMUST00000143498] [ENSMUST00000164406] [ENSMUST00000168223]
Predicted Effect probably benign
Transcript: ENSMUST00000015846
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039537
AA Change: D243G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043910
Gene: ENSMUSG00000038712
AA Change: D243G

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107183
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107187
AA Change: D243G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102805
Gene: ENSMUSG00000038712
AA Change: D243G

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 266 7e-42 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 400 406 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143498
Predicted Effect probably benign
Transcript: ENSMUST00000164406
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168223
AA Change: D243G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127839
Gene: ENSMUSG00000038712
AA Change: D243G

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,288,715 I1402S probably damaging Het
Abca9 T C 11: 110,141,583 D736G probably benign Het
Acy1 T C 9: 106,433,178 E377G probably damaging Het
Apob G A 12: 8,008,270 V2251M probably damaging Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Cabin1 T C 10: 75,751,576 K129R probably benign Het
Cdh24 A T 14: 54,638,336 F259I probably benign Het
Cops6 A G 5: 138,163,821 N307S probably benign Het
Cyp4a31 G A 4: 115,566,572 V143M probably damaging Het
Deaf1 A T 7: 141,297,531 I561K probably benign Het
Dnah7a A C 1: 53,433,016 S3531A probably benign Het
Dnajc14 T A 10: 128,807,031 I274N probably damaging Het
Dnmt1 A G 9: 20,941,781 L48S probably damaging Het
Efna4 A T 3: 89,335,242 I115N probably damaging Het
Ermp1 T A 19: 29,616,693 L692F probably benign Het
Fcho2 GT G 13: 98,745,874 probably null Het
Fermt2 A T 14: 45,504,642 C82* probably null Het
Fuk A T 8: 110,889,090 C536S probably benign Het
Gabra6 G T 11: 42,319,710 D61E probably damaging Het
Gdpd4 T A 7: 98,040,933 S611T probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm17430 G A 18: 9,726,336 A112V probably benign Het
Gm2381 A T 7: 42,822,647 L2Q probably damaging Het
Gm9268 G T 7: 43,047,684 A722S probably benign Het
Hif3a A T 7: 17,054,776 L90Q probably benign Het
Irf3 C T 7: 45,000,465 Q168* probably null Het
Krt82 T G 15: 101,548,393 D184A possibly damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrrc49 A G 9: 60,687,162 S28P probably damaging Het
Mfsd11 T A 11: 116,861,617 N197K probably benign Het
Mphosph9 A T 5: 124,312,812 W299R probably damaging Het
Mst1r G T 9: 107,914,851 R862L possibly damaging Het
Nasp T A 4: 116,612,083 probably null Het
Ncapg2 T C 12: 116,450,429 I1073T probably damaging Het
Nek2 A T 1: 191,822,633 K152N probably benign Het
Neurod2 T C 11: 98,328,134 E68G probably benign Het
Olfr317 T C 11: 58,732,769 Y132C probably damaging Het
Olfr350 A T 2: 36,850,084 I13F probably benign Het
P4ha3 T A 7: 100,306,021 I361N probably damaging Het
Pcdh15 T A 10: 74,453,973 S875T possibly damaging Het
Pde7b G T 10: 20,547,893 P79Q probably benign Het
Phb2 G A 6: 124,715,134 A228T probably damaging Het
Piezo2 A T 18: 63,092,900 C888* probably null Het
Pkhd1 A T 1: 20,392,150 L2060Q probably damaging Het
Pms1 T C 1: 53,206,893 M496V probably benign Het
Ppfibp1 C T 6: 146,990,515 T91I probably benign Het
Ppp1r9b T C 11: 95,000,251 L557P probably damaging Het
Ppp2r5c G T 12: 110,522,598 V68L probably benign Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rasgrp1 G A 2: 117,284,872 T745I probably damaging Het
Rnf144a G A 12: 26,320,973 T163I probably benign Het
Sbsn A T 7: 30,752,097 H179L unknown Het
Simc1 G A 13: 54,525,380 V514I probably benign Het
Slc35d1 A G 4: 103,189,854 M249T Het
Slfn4 T A 11: 83,188,883 H466Q possibly damaging Het
Stab2 A T 10: 86,972,930 C172S probably damaging Het
Tanc1 T C 2: 59,843,645 I1698T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tiam2 A C 17: 3,428,807 D605A probably damaging Het
Tmed4 A T 11: 6,273,822 D151E probably benign Het
Trim62 A T 4: 128,900,672 I211F possibly damaging Het
Ttpa A G 4: 20,008,585 D49G probably benign Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Usp34 C T 11: 23,429,325 T1991I Het
Vash1 G A 12: 86,689,089 V250M possibly damaging Het
Vmn1r199 T C 13: 22,383,639 *368Q probably null Het
Vmn1r74 A G 7: 11,847,045 T91A probably benign Het
Vmn1r8 T C 6: 57,036,572 F203L probably benign Het
Vmn2r13 G T 5: 109,171,648 Q489K probably benign Het
Zfp385b A T 2: 77,719,627 V38E probably damaging Het
Zfp820 A G 17: 21,818,895 I484T probably benign Het
Other mutations in Mindy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Mindy1 APN 3 95288390 missense probably damaging 1.00
IGL03380:Mindy1 APN 3 95291018 splice site probably benign
ANU18:Mindy1 UTSW 3 95288390 missense probably damaging 1.00
PIT4576001:Mindy1 UTSW 3 95288069 missense probably benign 0.12
R4647:Mindy1 UTSW 3 95282743 unclassified probably benign
R5076:Mindy1 UTSW 3 95295399 missense probably benign 0.01
R5875:Mindy1 UTSW 3 95294814 missense probably damaging 0.98
R5938:Mindy1 UTSW 3 95293756 missense probably benign 0.18
R8112:Mindy1 UTSW 3 95294811 missense probably damaging 1.00
X0028:Mindy1 UTSW 3 95294895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTTTGTAAGAAAGCCAGAC -3'
(R):5'- TGACTCCGCCCAACATTAG -3'

Sequencing Primer
(F):5'- GCTAGACCAGCCATCTTGTC -3'
(R):5'- ACATTAGAATCCAAGGAATCCTGG -3'
Posted On2021-04-30