Incidental Mutation 'R8692:Mst1r'
ID668444
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Namemacrophage stimulating 1 receptor (c-met-related tyrosine kinase)
SynonymsFv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R8692 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107906873-107920383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107914851 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 862 (R862L)
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035203
AA Change: R862L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: R862L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,288,715 I1402S probably damaging Het
Abca9 T C 11: 110,141,583 D736G probably benign Het
Acy1 T C 9: 106,433,178 E377G probably damaging Het
Apob G A 12: 8,008,270 V2251M probably damaging Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Cabin1 T C 10: 75,751,576 K129R probably benign Het
Cdh24 A T 14: 54,638,336 F259I probably benign Het
Cops6 A G 5: 138,163,821 N307S probably benign Het
Cyp4a31 G A 4: 115,566,572 V143M probably damaging Het
Deaf1 A T 7: 141,297,531 I561K probably benign Het
Dnah7a A C 1: 53,433,016 S3531A probably benign Het
Dnajc14 T A 10: 128,807,031 I274N probably damaging Het
Dnmt1 A G 9: 20,941,781 L48S probably damaging Het
Efna4 A T 3: 89,335,242 I115N probably damaging Het
Ermp1 T A 19: 29,616,693 L692F probably benign Het
Fcho2 GT G 13: 98,745,874 probably null Het
Fermt2 A T 14: 45,504,642 C82* probably null Het
Fuk A T 8: 110,889,090 C536S probably benign Het
Gabra6 G T 11: 42,319,710 D61E probably damaging Het
Gdpd4 T A 7: 98,040,933 S611T probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm17430 G A 18: 9,726,336 A112V probably benign Het
Gm2381 A T 7: 42,822,647 L2Q probably damaging Het
Gm9268 G T 7: 43,047,684 A722S probably benign Het
Hif3a A T 7: 17,054,776 L90Q probably benign Het
Irf3 C T 7: 45,000,465 Q168* probably null Het
Krt82 T G 15: 101,548,393 D184A possibly damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrrc49 A G 9: 60,687,162 S28P probably damaging Het
Mfsd11 T A 11: 116,861,617 N197K probably benign Het
Mindy1 A G 3: 95,292,276 D243G probably damaging Het
Mphosph9 A T 5: 124,312,812 W299R probably damaging Het
Nasp T A 4: 116,612,083 probably null Het
Ncapg2 T C 12: 116,450,429 I1073T probably damaging Het
Nek2 A T 1: 191,822,633 K152N probably benign Het
Neurod2 T C 11: 98,328,134 E68G probably benign Het
Olfr317 T C 11: 58,732,769 Y132C probably damaging Het
Olfr350 A T 2: 36,850,084 I13F probably benign Het
P4ha3 T A 7: 100,306,021 I361N probably damaging Het
Pcdh15 T A 10: 74,453,973 S875T possibly damaging Het
Pde7b G T 10: 20,547,893 P79Q probably benign Het
Phb2 G A 6: 124,715,134 A228T probably damaging Het
Piezo2 A T 18: 63,092,900 C888* probably null Het
Pkhd1 A T 1: 20,392,150 L2060Q probably damaging Het
Pms1 T C 1: 53,206,893 M496V probably benign Het
Ppfibp1 C T 6: 146,990,515 T91I probably benign Het
Ppp1r9b T C 11: 95,000,251 L557P probably damaging Het
Ppp2r5c G T 12: 110,522,598 V68L probably benign Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rasgrp1 G A 2: 117,284,872 T745I probably damaging Het
Rnf144a G A 12: 26,320,973 T163I probably benign Het
Sbsn A T 7: 30,752,097 H179L unknown Het
Simc1 G A 13: 54,525,380 V514I probably benign Het
Slc35d1 A G 4: 103,189,854 M249T Het
Slfn4 T A 11: 83,188,883 H466Q possibly damaging Het
Stab2 A T 10: 86,972,930 C172S probably damaging Het
Tanc1 T C 2: 59,843,645 I1698T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tiam2 A C 17: 3,428,807 D605A probably damaging Het
Tmed4 A T 11: 6,273,822 D151E probably benign Het
Trim62 A T 4: 128,900,672 I211F possibly damaging Het
Ttpa A G 4: 20,008,585 D49G probably benign Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Usp34 C T 11: 23,429,325 T1991I Het
Vash1 G A 12: 86,689,089 V250M possibly damaging Het
Vmn1r199 T C 13: 22,383,639 *368Q probably null Het
Vmn1r74 A G 7: 11,847,045 T91A probably benign Het
Vmn1r8 T C 6: 57,036,572 F203L probably benign Het
Vmn2r13 G T 5: 109,171,648 Q489K probably benign Het
Zfp385b A T 2: 77,719,627 V38E probably damaging Het
Zfp820 A G 17: 21,818,895 I484T probably benign Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1479:Mst1r UTSW 9 107913345 splice site probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1971:Mst1r UTSW 9 107913212 missense probably benign 0.06
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2221:Mst1r UTSW 9 107908348 missense probably damaging 1.00
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6220:Mst1r UTSW 9 107907348 missense probably benign 0.11
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
R7168:Mst1r UTSW 9 107908193 missense probably benign 0.01
R7299:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107915122 missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107920012 missense probably benign 0.05
R7684:Mst1r UTSW 9 107911563 missense probably benign 0.01
R7741:Mst1r UTSW 9 107907120 start gained probably benign
R7916:Mst1r UTSW 9 107907578 missense probably damaging 1.00
R7987:Mst1r UTSW 9 107912798 splice site probably null
R8177:Mst1r UTSW 9 107907585 missense probably damaging 1.00
R8356:Mst1r UTSW 9 107917264 missense probably damaging 1.00
R8494:Mst1r UTSW 9 107914519 missense possibly damaging 0.90
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCTAACTACTTTCCCATGGG -3'
(R):5'- ATGTTGGCAGACCTCACCAC -3'

Sequencing Primer
(F):5'- TTCCCATGGGTCTCAGCAGTG -3'
(R):5'- GGTCATGTTCACAGTCACACAGTC -3'
Posted On2021-04-30