Incidental Mutation 'R8692:Neurod2'
ID668457
Institutional Source Beutler Lab
Gene Symbol Neurod2
Ensembl Gene ENSMUSG00000038255
Gene Nameneurogenic differentiation 2
SynonymsbHLHa1, Ndrf
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R8692 (G1)
Quality Score175.009
Status Not validated
Chromosome11
Chromosomal Location98325415-98329648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98328134 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 68 (E68G)
Ref Sequence ENSEMBL: ENSMUSP00000041373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041685]
Predicted Effect probably benign
Transcript: ENSMUST00000041685
AA Change: E68G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000041373
Gene: ENSMUSG00000038255
AA Change: E68G

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 76 111 N/A INTRINSIC
HLH 128 180 4.19e-17 SMART
Pfam:Neuro_bHLH 181 311 5.7e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuroD family of neurogenic basic helix-loop-helix (bHLH) proteins. Expression of this gene can induce transcription from neuron-specific promoters, such as the GAP-43 promoter, which contain a specific DNA sequence known as an E-box. The product of the human gene can induce neurogenic differentiation in non-neuronal cells in Xenopus embryos, and is thought to play a role in the determination and maintenance of neuronal cell fates. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation show elevated neuronal apoptosis resulting in ataxia, incoordination, elevated seizure susceptibility, and death by 35 days. Heterozygotes are moderately affected, and adults are subject to unexplained death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,288,715 I1402S probably damaging Het
Abca9 T C 11: 110,141,583 D736G probably benign Het
Acy1 T C 9: 106,433,178 E377G probably damaging Het
Apob G A 12: 8,008,270 V2251M probably damaging Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Cabin1 T C 10: 75,751,576 K129R probably benign Het
Cdh24 A T 14: 54,638,336 F259I probably benign Het
Cops6 A G 5: 138,163,821 N307S probably benign Het
Cyp4a31 G A 4: 115,566,572 V143M probably damaging Het
Deaf1 A T 7: 141,297,531 I561K probably benign Het
Dnah7a A C 1: 53,433,016 S3531A probably benign Het
Dnajc14 T A 10: 128,807,031 I274N probably damaging Het
Dnmt1 A G 9: 20,941,781 L48S probably damaging Het
Efna4 A T 3: 89,335,242 I115N probably damaging Het
Ermp1 T A 19: 29,616,693 L692F probably benign Het
Fcho2 GT G 13: 98,745,874 probably null Het
Fermt2 A T 14: 45,504,642 C82* probably null Het
Fuk A T 8: 110,889,090 C536S probably benign Het
Gabra6 G T 11: 42,319,710 D61E probably damaging Het
Gdpd4 T A 7: 98,040,933 S611T probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm17430 G A 18: 9,726,336 A112V probably benign Het
Gm2381 A T 7: 42,822,647 L2Q probably damaging Het
Gm9268 G T 7: 43,047,684 A722S probably benign Het
Hif3a A T 7: 17,054,776 L90Q probably benign Het
Irf3 C T 7: 45,000,465 Q168* probably null Het
Krt82 T G 15: 101,548,393 D184A possibly damaging Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrrc49 A G 9: 60,687,162 S28P probably damaging Het
Mfsd11 T A 11: 116,861,617 N197K probably benign Het
Mindy1 A G 3: 95,292,276 D243G probably damaging Het
Mphosph9 A T 5: 124,312,812 W299R probably damaging Het
Mst1r G T 9: 107,914,851 R862L possibly damaging Het
Nasp T A 4: 116,612,083 probably null Het
Ncapg2 T C 12: 116,450,429 I1073T probably damaging Het
Nek2 A T 1: 191,822,633 K152N probably benign Het
Olfr317 T C 11: 58,732,769 Y132C probably damaging Het
Olfr350 A T 2: 36,850,084 I13F probably benign Het
P4ha3 T A 7: 100,306,021 I361N probably damaging Het
Pcdh15 T A 10: 74,453,973 S875T possibly damaging Het
Pde7b G T 10: 20,547,893 P79Q probably benign Het
Phb2 G A 6: 124,715,134 A228T probably damaging Het
Piezo2 A T 18: 63,092,900 C888* probably null Het
Pkhd1 A T 1: 20,392,150 L2060Q probably damaging Het
Pms1 T C 1: 53,206,893 M496V probably benign Het
Ppfibp1 C T 6: 146,990,515 T91I probably benign Het
Ppp1r9b T C 11: 95,000,251 L557P probably damaging Het
Ppp2r5c G T 12: 110,522,598 V68L probably benign Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rasgrp1 G A 2: 117,284,872 T745I probably damaging Het
Rnf144a G A 12: 26,320,973 T163I probably benign Het
Sbsn A T 7: 30,752,097 H179L unknown Het
Simc1 G A 13: 54,525,380 V514I probably benign Het
Slc35d1 A G 4: 103,189,854 M249T Het
Slfn4 T A 11: 83,188,883 H466Q possibly damaging Het
Stab2 A T 10: 86,972,930 C172S probably damaging Het
Tanc1 T C 2: 59,843,645 I1698T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tiam2 A C 17: 3,428,807 D605A probably damaging Het
Tmed4 A T 11: 6,273,822 D151E probably benign Het
Trim62 A T 4: 128,900,672 I211F possibly damaging Het
Ttpa A G 4: 20,008,585 D49G probably benign Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Usp34 C T 11: 23,429,325 T1991I Het
Vash1 G A 12: 86,689,089 V250M possibly damaging Het
Vmn1r199 T C 13: 22,383,639 *368Q probably null Het
Vmn1r74 A G 7: 11,847,045 T91A probably benign Het
Vmn1r8 T C 6: 57,036,572 F203L probably benign Het
Vmn2r13 G T 5: 109,171,648 Q489K probably benign Het
Zfp385b A T 2: 77,719,627 V38E probably damaging Het
Zfp820 A G 17: 21,818,895 I484T probably benign Het
Other mutations in Neurod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Neurod2 APN 11 98327769 missense probably damaging 1.00
IGL01751:Neurod2 APN 11 98327375 missense possibly damaging 0.94
IGL01752:Neurod2 APN 11 98327375 missense possibly damaging 0.94
IGL02661:Neurod2 APN 11 98327579 missense possibly damaging 0.65
hesitate UTSW 11 98327756 missense probably damaging 1.00
R5181_Neurod2_559 UTSW 11 98327378 missense probably benign 0.43
selection UTSW 11 98327321 missense probably benign 0.01
PIT4362001:Neurod2 UTSW 11 98327882 missense probably damaging 1.00
R0904:Neurod2 UTSW 11 98327321 missense probably benign 0.01
R0989:Neurod2 UTSW 11 98327979 missense probably damaging 1.00
R1290:Neurod2 UTSW 11 98327288 missense possibly damaging 0.69
R1564:Neurod2 UTSW 11 98327424 missense probably damaging 0.96
R1712:Neurod2 UTSW 11 98327203 missense probably damaging 1.00
R1901:Neurod2 UTSW 11 98327732 missense probably damaging 1.00
R2129:Neurod2 UTSW 11 98327588 missense possibly damaging 0.73
R2267:Neurod2 UTSW 11 98327756 missense probably damaging 1.00
R3754:Neurod2 UTSW 11 98327700 missense probably damaging 1.00
R4421:Neurod2 UTSW 11 98328200 nonsense probably null
R5067:Neurod2 UTSW 11 98327237 missense possibly damaging 0.71
R5181:Neurod2 UTSW 11 98327378 missense probably benign 0.43
R7922:Neurod2 UTSW 11 98327628 missense probably benign 0.00
R7976:Neurod2 UTSW 11 98327197 missense probably damaging 0.97
R8842:Neurod2 UTSW 11 98327681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGCGTCTTGGAGTAGCAG -3'
(R):5'- TCTCGGACGTGCCCAAGTT -3'

Sequencing Primer
(F):5'- TCTTGGAGTAGCAGGGCAC -3'
(R):5'- TGCCCAAGTTCGCCAGC -3'
Posted On2021-04-30