Incidental Mutation 'R8693:Plcb1'
ID668481
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R8693 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135252776 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 174 (I174V)
Ref Sequence ENSEMBL: ENSMUSP00000105743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: I174V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: I174V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: I174V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: I174V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: I174V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: I174V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201485
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,229,008 M2246T probably benign Het
Abcc2 T C 19: 43,822,035 S924P probably benign Het
Acacb A G 5: 114,226,783 H1508R probably damaging Het
Adam34 T C 8: 43,651,604 M335V probably benign Het
Akap8 A T 17: 32,310,651 N438K probably damaging Het
Alpi C A 1: 87,098,683 G529C unknown Het
Arhgap30 T C 1: 171,397,526 V50A probably damaging Het
Armh1 T C 4: 117,231,763 E145G probably damaging Het
Ccdc177 A G 12: 80,757,808 L564P unknown Het
Cdk12 C T 11: 98,250,307 P1458L unknown Het
Chek1 A G 9: 36,713,844 F314L probably benign Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Cnot3 T C 7: 3,653,523 V239A probably benign Het
Crhr2 A G 6: 55,102,794 F187S possibly damaging Het
Dchs2 T A 3: 83,285,324 V1692D probably damaging Het
Dctd T A 8: 48,112,011 I57N probably damaging Het
Dennd5b A T 6: 149,009,774 L977* probably null Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dysf T C 6: 84,111,970 S865P probably damaging Het
Eif2ak3 A T 6: 70,881,551 I275F possibly damaging Het
Eif2ak4 T A 2: 118,432,237 I757N probably damaging Het
Exog A G 9: 119,447,042 Q110R possibly damaging Het
Fbxl4 T C 4: 22,403,704 C426R probably benign Het
Fndc11 A C 2: 181,222,071 H223P probably damaging Het
Frmd3 T A 4: 74,162,049 S334R probably damaging Het
Galnt14 A T 17: 73,526,262 I239N probably damaging Het
Gm5930 C T 14: 44,338,558 M1I probably null Het
Igkv4-63 A G 6: 69,378,067 S77P probably benign Het
Igkv5-48 G A 6: 69,726,795 S42F probably damaging Het
Kalrn T A 16: 34,034,514 Y1992F probably damaging Het
Kmt2a T C 9: 44,810,684 Y3788C unknown Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lpo T C 11: 87,809,240 N525S probably benign Het
Med1 T C 11: 98,155,773 H1399R unknown Het
Mga T A 2: 119,963,926 V2697E possibly damaging Het
Msto1 T C 3: 88,911,877 T188A probably benign Het
Nrap T C 19: 56,321,952 H1456R probably damaging Het
Olfr959 G T 9: 39,572,504 P252T probably damaging Het
Pbld1 A T 10: 63,075,111 K248* probably null Het
Pcdhb12 G A 18: 37,437,421 R540H probably benign Het
Pcx G T 19: 4,602,011 A96S probably damaging Het
Psme3 T C 11: 101,320,596 I193T probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rph3a A T 5: 120,962,438 H132Q probably damaging Het
Scrib C A 15: 76,064,505 D501Y probably damaging Het
Sdad1 C A 5: 92,304,998 R127L probably benign Het
Setdb1 T C 3: 95,341,730 T356A probably damaging Het
Sh3bgrl3 T C 4: 134,127,805 D73G probably benign Het
Sipa1l1 G T 12: 82,169,743 probably benign Het
Slc17a8 G A 10: 89,592,896 A261V probably benign Het
Sox6 T A 7: 115,662,397 I195F probably damaging Het
Syne1 T C 10: 5,140,928 K809E possibly damaging Het
Tmem30c G A 16: 57,266,492 T316M probably damaging Het
Tnfrsf19 T C 14: 60,971,002 T357A probably benign Het
Top2a T A 11: 99,010,042 T574S probably damaging Het
Trappc3l G A 10: 34,098,921 C133Y probably damaging Het
Unk C T 11: 116,047,814 T81I probably damaging Het
Vamp1 G A 6: 125,240,425 R144K unknown Het
Wnt9b T C 11: 103,733,661 N101S probably damaging Het
Wwtr1 T A 3: 57,462,524 D390V probably damaging Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8061:Plcb1 UTSW 2 135346396 missense probably benign
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135250052 critical splice donor site probably null
R8549:Plcb1 UTSW 2 135364933 missense probably benign 0.00
R8750:Plcb1 UTSW 2 135335449 missense probably damaging 1.00
R8950:Plcb1 UTSW 2 135337519 missense probably damaging 1.00
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGTAGTTTTCATTGGGTCATCTCCAC -3'
(R):5'- CTCAATTGCATCAAGCTATGTCTAC -3'

Sequencing Primer
(F):5'- CCACTACCTTAGAATCTTGATTGTG -3'
(R):5'- GCTATGTCTACAAAACACTAGGCAG -3'
Posted On2021-04-30