Incidental Mutation 'R8693:Rph3a'
ID668493
Institutional Source Beutler Lab
Gene Symbol Rph3a
Ensembl Gene ENSMUSG00000029608
Gene Namerabphilin 3A
Synonyms2900002P20Rik, Doc2 family
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8693 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location120940499-121010092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120962438 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 132 (H132Q)
Ref Sequence ENSEMBL: ENSMUSP00000078198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079204] [ENSMUST00000202326] [ENSMUST00000202406]
PDB Structure Structural determinants for Ca2+ and PIP2 binding by the C2A domain of rabphilin-3A [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000079204
AA Change: H132Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078198
Gene: ENSMUSG00000029608
AA Change: H132Q

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202326
AA Change: H132Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144291
Gene: ENSMUSG00000029608
AA Change: H132Q

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202406
AA Change: H132Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143917
Gene: ENSMUSG00000029608
AA Change: H132Q

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an effector for RAB3A, which is a small G protein that acts in the late stages of neurotransmitter exocytosis. The encoded protein may be involved in neurotransmitter release and synaptic vesicle traffic. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutants are viable and fertile and do not exhibit any obvious abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,229,008 M2246T probably benign Het
Abcc2 T C 19: 43,822,035 S924P probably benign Het
Acacb A G 5: 114,226,783 H1508R probably damaging Het
Adam34 T C 8: 43,651,604 M335V probably benign Het
Akap8 A T 17: 32,310,651 N438K probably damaging Het
Alpi C A 1: 87,098,683 G529C unknown Het
Arhgap30 T C 1: 171,397,526 V50A probably damaging Het
Armh1 T C 4: 117,231,763 E145G probably damaging Het
Ccdc177 A G 12: 80,757,808 L564P unknown Het
Cdk12 C T 11: 98,250,307 P1458L unknown Het
Chek1 A G 9: 36,713,844 F314L probably benign Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Cnot3 T C 7: 3,653,523 V239A probably benign Het
Crhr2 A G 6: 55,102,794 F187S possibly damaging Het
Dchs2 T A 3: 83,285,324 V1692D probably damaging Het
Dctd T A 8: 48,112,011 I57N probably damaging Het
Dennd5b A T 6: 149,009,774 L977* probably null Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dysf T C 6: 84,111,970 S865P probably damaging Het
Eif2ak3 A T 6: 70,881,551 I275F possibly damaging Het
Eif2ak4 T A 2: 118,432,237 I757N probably damaging Het
Exog A G 9: 119,447,042 Q110R possibly damaging Het
Fbxl4 T C 4: 22,403,704 C426R probably benign Het
Fndc11 A C 2: 181,222,071 H223P probably damaging Het
Frmd3 T A 4: 74,162,049 S334R probably damaging Het
Galnt14 A T 17: 73,526,262 I239N probably damaging Het
Gm5930 C T 14: 44,338,558 M1I probably null Het
Igkv4-63 A G 6: 69,378,067 S77P probably benign Het
Igkv5-48 G A 6: 69,726,795 S42F probably damaging Het
Kalrn T A 16: 34,034,514 Y1992F probably damaging Het
Kmt2a T C 9: 44,810,684 Y3788C unknown Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lpo T C 11: 87,809,240 N525S probably benign Het
Med1 T C 11: 98,155,773 H1399R unknown Het
Mga T A 2: 119,963,926 V2697E possibly damaging Het
Msto1 T C 3: 88,911,877 T188A probably benign Het
Nrap T C 19: 56,321,952 H1456R probably damaging Het
Olfr959 G T 9: 39,572,504 P252T probably damaging Het
Pbld1 A T 10: 63,075,111 K248* probably null Het
Pcdhb12 G A 18: 37,437,421 R540H probably benign Het
Pcx G T 19: 4,602,011 A96S probably damaging Het
Plcb1 A G 2: 135,252,776 I174V probably benign Het
Psme3 T C 11: 101,320,596 I193T probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Scrib C A 15: 76,064,505 D501Y probably damaging Het
Sdad1 C A 5: 92,304,998 R127L probably benign Het
Setdb1 T C 3: 95,341,730 T356A probably damaging Het
Sh3bgrl3 T C 4: 134,127,805 D73G probably benign Het
Sipa1l1 G T 12: 82,169,743 probably benign Het
Slc17a8 G A 10: 89,592,896 A261V probably benign Het
Sox6 T A 7: 115,662,397 I195F probably damaging Het
Syne1 T C 10: 5,140,928 K809E possibly damaging Het
Tmem30c G A 16: 57,266,492 T316M probably damaging Het
Tnfrsf19 T C 14: 60,971,002 T357A probably benign Het
Top2a T A 11: 99,010,042 T574S probably damaging Het
Trappc3l G A 10: 34,098,921 C133Y probably damaging Het
Unk C T 11: 116,047,814 T81I probably damaging Het
Vamp1 G A 6: 125,240,425 R144K unknown Het
Wnt9b T C 11: 103,733,661 N101S probably damaging Het
Wwtr1 T A 3: 57,462,524 D390V probably damaging Het
Other mutations in Rph3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Rph3a APN 5 120948833 missense probably damaging 1.00
IGL02383:Rph3a APN 5 120963939 missense probably damaging 1.00
IGL02394:Rph3a APN 5 120946348 splice site probably null
IGL02429:Rph3a APN 5 120980124 splice site probably null
IGL02825:Rph3a APN 5 120945446 missense possibly damaging 0.94
R0282:Rph3a UTSW 5 120963910 nonsense probably null
R0325:Rph3a UTSW 5 120943064 missense probably benign 0.22
R0402:Rph3a UTSW 5 120942254 missense probably damaging 0.99
R0648:Rph3a UTSW 5 120959270 missense possibly damaging 0.77
R1807:Rph3a UTSW 5 120945393 missense probably damaging 0.99
R2273:Rph3a UTSW 5 120973304 missense probably damaging 0.98
R2519:Rph3a UTSW 5 120954422 missense probably damaging 1.00
R2865:Rph3a UTSW 5 120947927 missense probably damaging 1.00
R2939:Rph3a UTSW 5 120980149 splice site probably benign
R3153:Rph3a UTSW 5 120973377 missense probably damaging 1.00
R4289:Rph3a UTSW 5 120973305 missense probably damaging 1.00
R4775:Rph3a UTSW 5 120954488 missense probably benign 0.00
R4949:Rph3a UTSW 5 120963834 missense probably damaging 1.00
R4997:Rph3a UTSW 5 120963843 missense probably damaging 0.96
R5008:Rph3a UTSW 5 120945391 missense probably damaging 1.00
R5027:Rph3a UTSW 5 120954449 missense possibly damaging 0.90
R5155:Rph3a UTSW 5 120948770 missense possibly damaging 0.94
R5497:Rph3a UTSW 5 120942190 missense probably benign 0.28
R5931:Rph3a UTSW 5 120963873 missense probably damaging 0.99
R6273:Rph3a UTSW 5 120945422 missense possibly damaging 0.91
R7630:Rph3a UTSW 5 120943050 missense probably damaging 1.00
R7664:Rph3a UTSW 5 120961276 missense probably benign
R8210:Rph3a UTSW 5 120961249 missense probably benign 0.00
R8294:Rph3a UTSW 5 120961366 missense probably damaging 1.00
R8445:Rph3a UTSW 5 120973370 missense probably damaging 1.00
R8758:Rph3a UTSW 5 120959302 missense probably benign
RF017:Rph3a UTSW 5 120962499 splice site probably null
Z1177:Rph3a UTSW 5 120942266 nonsense probably null
Z1177:Rph3a UTSW 5 120961275 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAAGATCTGCTGTCTCACCAG -3'
(R):5'- GGCTTTTGCTCCCGCTAAAAG -3'

Sequencing Primer
(F):5'- CACTCCAGTGCTAAGATTACAGGTG -3'
(R):5'- TTGCTCCCGCTAAAAGATCTTGAAC -3'
Posted On2021-04-30