Incidental Mutation 'R8693:Akap8'
ID 668531
Institutional Source Beutler Lab
Gene Symbol Akap8
Ensembl Gene ENSMUSG00000024045
Gene Name A kinase (PRKA) anchor protein 8
Synonyms 1200016A02Rik, AKAP95
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8693 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 32303676-32321153 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32310651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 438 (N438K)
Ref Sequence ENSEMBL: ENSMUSP00000002699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002699]
AlphaFold Q9DBR0
Predicted Effect probably damaging
Transcript: ENSMUST00000002699
AA Change: N438K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045
AA Change: N438K

DomainStartEndE-ValueType
SCOP:d1a0tp_ 12 108 3e-19 SMART
low complexity region 183 198 N/A INTRINSIC
low complexity region 257 270 N/A INTRINSIC
low complexity region 354 384 N/A INTRINSIC
ZnF_C2H2 387 411 9.46e0 SMART
Blast:ZnF_C2H2 476 501 9e-9 BLAST
low complexity region 551 582 N/A INTRINSIC
low complexity region 642 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the A-kinase anchoring protein (AKAP) family. These proteins are characterized by their ability to bind to the R subunit of protein kinase A (PKA) and anchor the protein at different subcellular locations. This protein has been shown to regulate apoptosis and to be involved in palatogenesis. Knockdown of this gene has been associated with altered histone modifications and reduced expression of developmental genes in mouse embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,229,008 M2246T probably benign Het
Abcc2 T C 19: 43,822,035 S924P probably benign Het
Acacb A G 5: 114,226,783 H1508R probably damaging Het
Adam34 T C 8: 43,651,604 M335V probably benign Het
Alpi C A 1: 87,098,683 G529C unknown Het
Arhgap30 T C 1: 171,397,526 V50A probably damaging Het
Armh1 T C 4: 117,231,763 E145G probably damaging Het
Ccdc177 A G 12: 80,757,808 L564P unknown Het
Cdk12 C T 11: 98,250,307 P1458L unknown Het
Chek1 A G 9: 36,713,844 F314L probably benign Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Cnot3 T C 7: 3,653,523 V239A probably benign Het
Crhr2 A G 6: 55,102,794 F187S possibly damaging Het
Dchs2 T A 3: 83,285,324 V1692D probably damaging Het
Dctd T A 8: 48,112,011 I57N probably damaging Het
Dennd5b A T 6: 149,009,774 L977* probably null Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dysf T C 6: 84,111,970 S865P probably damaging Het
Eif2ak3 A T 6: 70,881,551 I275F possibly damaging Het
Eif2ak4 T A 2: 118,432,237 I757N probably damaging Het
Exog A G 9: 119,447,042 Q110R possibly damaging Het
Fbxl4 T C 4: 22,403,704 C426R probably benign Het
Fndc11 A C 2: 181,222,071 H223P probably damaging Het
Frmd3 T A 4: 74,162,049 S334R probably damaging Het
Galnt14 A T 17: 73,526,262 I239N probably damaging Het
Gm5930 C T 14: 44,338,558 M1I probably null Het
Igkv4-63 A G 6: 69,378,067 S77P probably benign Het
Igkv5-48 G A 6: 69,726,795 S42F probably damaging Het
Kalrn T A 16: 34,034,514 Y1992F probably damaging Het
Kmt2a T C 9: 44,810,684 Y3788C unknown Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lpo T C 11: 87,809,240 N525S probably benign Het
Med1 T C 11: 98,155,773 H1399R unknown Het
Mga T A 2: 119,963,926 V2697E possibly damaging Het
Msto1 T C 3: 88,911,877 T188A probably benign Het
Nrap T C 19: 56,321,952 H1456R probably damaging Het
Olfr959 G T 9: 39,572,504 P252T probably damaging Het
Pbld1 A T 10: 63,075,111 K248* probably null Het
Pcdhb12 G A 18: 37,437,421 R540H probably benign Het
Pcx G T 19: 4,602,011 A96S probably damaging Het
Plcb1 A G 2: 135,252,776 I174V probably benign Het
Psme3 T C 11: 101,320,596 I193T probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rph3a A T 5: 120,962,438 H132Q probably damaging Het
Scrib C A 15: 76,064,505 D501Y probably damaging Het
Sdad1 C A 5: 92,304,998 R127L probably benign Het
Setdb1 T C 3: 95,341,730 T356A probably damaging Het
Sh3bgrl3 T C 4: 134,127,805 D73G probably benign Het
Sipa1l1 G T 12: 82,169,743 probably benign Het
Slc17a8 G A 10: 89,592,896 A261V probably benign Het
Sox6 T A 7: 115,662,397 I195F probably damaging Het
Syne1 T C 10: 5,140,928 K809E possibly damaging Het
Tmem30c G A 16: 57,266,492 T316M probably damaging Het
Tnfrsf19 T C 14: 60,971,002 T357A probably benign Het
Top2a T A 11: 99,010,042 T574S probably damaging Het
Trappc3l G A 10: 34,098,921 C133Y probably damaging Het
Unk C T 11: 116,047,814 T81I probably damaging Het
Vamp1 G A 6: 125,240,425 R144K unknown Het
Wnt9b T C 11: 103,733,661 N101S probably damaging Het
Wwtr1 T A 3: 57,462,524 D390V probably damaging Het
Other mutations in Akap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Akap8 APN 17 32317280 missense probably damaging 1.00
IGL01450:Akap8 APN 17 32315687 missense probably damaging 1.00
IGL02002:Akap8 APN 17 32309496 missense probably damaging 1.00
IGL02223:Akap8 APN 17 32316647 missense probably damaging 1.00
IGL02315:Akap8 APN 17 32305501 missense probably benign 0.01
IGL03404:Akap8 APN 17 32312276 splice site probably benign
BB006:Akap8 UTSW 17 32309445 missense probably damaging 1.00
BB016:Akap8 UTSW 17 32309445 missense probably damaging 1.00
R0310:Akap8 UTSW 17 32316260 missense possibly damaging 0.81
R0526:Akap8 UTSW 17 32317292 missense probably benign 0.28
R1795:Akap8 UTSW 17 32315477 missense probably damaging 1.00
R1992:Akap8 UTSW 17 32316612 missense probably damaging 0.99
R2571:Akap8 UTSW 17 32315455 missense probably damaging 1.00
R2918:Akap8 UTSW 17 32305648 missense probably benign 0.01
R3423:Akap8 UTSW 17 32316455 missense possibly damaging 0.61
R3870:Akap8 UTSW 17 32317839 unclassified probably benign
R4077:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4078:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4379:Akap8 UTSW 17 32306560 missense probably damaging 0.99
R4756:Akap8 UTSW 17 32316210 missense probably damaging 0.98
R4819:Akap8 UTSW 17 32312305 missense probably damaging 1.00
R5091:Akap8 UTSW 17 32316234 missense probably benign 0.05
R5761:Akap8 UTSW 17 32317185 missense possibly damaging 0.56
R6896:Akap8 UTSW 17 32317331 missense probably benign 0.00
R7138:Akap8 UTSW 17 32316541 missense possibly damaging 0.86
R7350:Akap8 UTSW 17 32316575 missense possibly damaging 0.92
R7929:Akap8 UTSW 17 32309445 missense probably damaging 1.00
R8810:Akap8 UTSW 17 32306530 missense probably damaging 1.00
R9521:Akap8 UTSW 17 32311062 missense possibly damaging 0.89
X0020:Akap8 UTSW 17 32315750 missense probably benign 0.08
Z1176:Akap8 UTSW 17 32306549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTCATACATGCTAAGTACTGC -3'
(R):5'- ACAGAGTGACAACAGCTCTG -3'

Sequencing Primer
(F):5'- CATGTCTATGTGAACAGAAGCC -3'
(R):5'- TCTGACCACAGCAGGTTCTG -3'
Posted On 2021-04-30