Incidental Mutation 'R8694:Ccdc187'
ID 668544
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8694 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26275493 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 884 (T884A)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably benign
Transcript: ENSMUST00000057224
AA Change: T884A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: T884A

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: T884A
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: T923A
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,510,769 D1735G probably benign Het
Adar T C 3: 89,735,643 L277P probably damaging Het
Adgrb3 C A 1: 25,826,391 D124Y probably damaging Het
Afdn T C 17: 13,888,379 V1403A probably benign Het
Afg3l1 T C 8: 123,501,234 V586A probably damaging Het
Aloxe3 A G 11: 69,142,851 D597G probably damaging Het
Asb15 T C 6: 24,570,667 V548A probably benign Het
Atp6v1a C T 16: 44,101,628 R388Q probably damaging Het
C130074G19Rik G A 1: 184,882,987 T2M probably damaging Het
Cdk5rap1 G A 2: 154,353,228 R356* probably null Het
Cebpz A T 17: 78,926,905 H725Q probably damaging Het
Celsr2 T C 3: 108,406,860 D1283G probably damaging Het
Cldn11 G T 3: 31,163,090 V136F probably damaging Het
Cpxm2 T C 7: 132,080,054 N249D probably benign Het
Ctsz T C 2: 174,438,279 N67D probably benign Het
Drd3 A C 16: 43,822,712 H405P probably damaging Het
F2rl2 T C 13: 95,700,831 V128A probably benign Het
Fh1 C T 1: 175,620,560 P43S probably benign Het
Fndc7 C T 3: 108,872,306 W307* probably null Het
Gm996 A G 2: 25,579,819 S27P possibly damaging Het
Gmip G T 8: 69,817,835 V732L probably benign Het
Heatr4 A G 12: 83,980,264 F73S probably damaging Het
Iqcf4 T C 9: 106,570,912 probably benign Het
Itln1 T A 1: 171,531,711 Q67L probably damaging Het
Jak1 A G 4: 101,156,507 V1008A probably damaging Het
Kcnh1 A T 1: 192,238,723 probably benign Het
Kcnu1 T G 8: 25,852,073 probably benign Het
Kif1b A G 4: 149,220,567 S967P probably damaging Het
Klra17 A G 6: 129,874,817 S31P probably benign Het
Kmt2d C T 15: 98,844,734 E4182K unknown Het
Lama5 T C 2: 180,180,884 D2825G probably damaging Het
Lmtk2 T C 5: 144,171,748 V336A probably damaging Het
Mad1l1 A G 5: 140,088,683 I584T probably benign Het
Magea1 T A X: 155,088,791 N313I possibly damaging Het
Mapt T C 11: 104,298,614 S153P probably benign Het
Myo1e T C 9: 70,383,890 Y988H probably benign Het
Ndufc2 A T 7: 97,400,196 N3I probably benign Het
Nos2 T A 11: 78,945,689 V531D possibly damaging Het
Npbwr1 T A 1: 5,916,398 Y299F probably damaging Het
Olfr1100 G A 2: 86,978,247 P183L probably damaging Het
Olfr1238 A G 2: 89,407,034 L15P probably damaging Het
Olfr1242 A G 2: 89,493,827 Y162H possibly damaging Het
Olfr659 G T 7: 104,671,089 C129F probably damaging Het
Pp2d1 T C 17: 53,508,163 Y511C probably benign Het
Psmb4 T C 3: 94,886,124 N149D probably benign Het
Setbp1 T C 18: 78,858,301 K717R probably damaging Het
Slc25a11 T C 11: 70,644,804 M303V probably benign Het
Spesp1 A T 9: 62,272,960 M222K probably benign Het
Tmem132d A G 5: 127,792,431 M613T probably benign Het
Ugt2a2 A G 5: 87,464,170 F294L probably damaging Het
Usp34 A G 11: 23,484,161 T3246A Het
Zfp750 T A 11: 121,513,630 I140F possibly damaging Het
Zscan4e A T 7: 11,307,647 H127Q possibly damaging Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26275565 missense possibly damaging 0.61
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26281067 missense probably benign
R9214:Ccdc187 UTSW 2 26293397 missense probably benign 0.19
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATGTGTGAAATGGGCCACTG -3'
(R):5'- GCCATAGCTGTCTTGTCCTGTG -3'

Sequencing Primer
(F):5'- GCCAGAGGCCGAAGAGC -3'
(R):5'- AGGCTCTTCCTGAAGCCTG -3'
Posted On 2021-04-30