Incidental Mutation 'R8694:Cdk5rap1'
ID668548
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene NameCDK5 regulatory subunit associated protein 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R8694 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154335380-154373010 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 154353228 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 356 (R356*)
Ref Sequence ENSEMBL: ENSMUSP00000028990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109731]
Predicted Effect probably null
Transcript: ENSMUST00000028990
AA Change: R356*
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487
AA Change: R356*

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109731
AA Change: R356*
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487
AA Change: R356*

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik A G 5: 107,510,769 D1735G probably benign Het
Adar T C 3: 89,735,643 L277P probably damaging Het
Adgrb3 C A 1: 25,826,391 D124Y probably damaging Het
Afdn T C 17: 13,888,379 V1403A probably benign Het
Afg3l1 T C 8: 123,501,234 V586A probably damaging Het
Aloxe3 A G 11: 69,142,851 D597G probably damaging Het
Asb15 T C 6: 24,570,667 V548A probably benign Het
Atp6v1a C T 16: 44,101,628 R388Q probably damaging Het
C130074G19Rik G A 1: 184,882,987 T2M probably damaging Het
Ccdc187 T C 2: 26,275,493 T884A probably benign Het
Cebpz A T 17: 78,926,905 H725Q probably damaging Het
Celsr2 T C 3: 108,406,860 D1283G probably damaging Het
Cldn11 G T 3: 31,163,090 V136F probably damaging Het
Cpxm2 T C 7: 132,080,054 N249D probably benign Het
Ctsz T C 2: 174,438,279 N67D probably benign Het
Drd3 A C 16: 43,822,712 H405P probably damaging Het
F2rl2 T C 13: 95,700,831 V128A probably benign Het
Fh1 C T 1: 175,620,560 P43S probably benign Het
Fndc7 C T 3: 108,872,306 W307* probably null Het
Gm996 A G 2: 25,579,819 S27P possibly damaging Het
Gmip G T 8: 69,817,835 V732L probably benign Het
Heatr4 A G 12: 83,980,264 F73S probably damaging Het
Iqcf4 T C 9: 106,570,912 probably benign Het
Itln1 T A 1: 171,531,711 Q67L probably damaging Het
Jak1 A G 4: 101,156,507 V1008A probably damaging Het
Kcnh1 A T 1: 192,238,723 probably benign Het
Kcnu1 T G 8: 25,852,073 probably benign Het
Kif1b A G 4: 149,220,567 S967P probably damaging Het
Klra17 A G 6: 129,874,817 S31P probably benign Het
Kmt2d C T 15: 98,844,734 E4182K unknown Het
Lama5 T C 2: 180,180,884 D2825G probably damaging Het
Lmtk2 T C 5: 144,171,748 V336A probably damaging Het
Mad1l1 A G 5: 140,088,683 I584T probably benign Het
Magea1 T A X: 155,088,791 N313I possibly damaging Het
Mapt T C 11: 104,298,614 S153P probably benign Het
Myo1e T C 9: 70,383,890 Y988H probably benign Het
Ndufc2 A T 7: 97,400,196 N3I probably benign Het
Nos2 T A 11: 78,945,689 V531D possibly damaging Het
Npbwr1 T A 1: 5,916,398 Y299F probably damaging Het
Olfr1100 G A 2: 86,978,247 P183L probably damaging Het
Olfr1238 A G 2: 89,407,034 L15P probably damaging Het
Olfr1242 A G 2: 89,493,827 Y162H possibly damaging Het
Olfr659 G T 7: 104,671,089 C129F probably damaging Het
Pp2d1 T C 17: 53,508,163 Y511C probably benign Het
Psmb4 T C 3: 94,886,124 N149D probably benign Het
Setbp1 T C 18: 78,858,301 K717R probably damaging Het
Slc25a11 T C 11: 70,644,804 M303V probably benign Het
Spesp1 A T 9: 62,272,960 M222K probably benign Het
Tmem132d A G 5: 127,792,431 M613T probably benign Het
Ugt2a2 A G 5: 87,464,170 F294L probably damaging Het
Usp34 A G 11: 23,484,161 T3246A Het
Zfp750 T A 11: 121,513,630 I140F possibly damaging Het
Zscan4e A T 7: 11,307,647 H127Q possibly damaging Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154366036 missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154335569 missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154365960 critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154370702 missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154360599 missense possibly damaging 0.96
R1333:Cdk5rap1 UTSW 2 154360654 missense probably damaging 0.97
R1552:Cdk5rap1 UTSW 2 154370695 missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154352251 missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154353246 missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154348716 missense probably damaging 1.00
R4126:Cdk5rap1 UTSW 2 154368895 missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154361835 makesense probably null
R4865:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154368874 missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154342395 missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154335569 missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154350835 missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154345974 missense probably benign 0.01
R5780:Cdk5rap1 UTSW 2 154345868 frame shift probably null
R6262:Cdk5rap1 UTSW 2 154370686 missense probably benign 0.04
R6274:Cdk5rap1 UTSW 2 154368241 missense probably damaging 0.99
R7263:Cdk5rap1 UTSW 2 154360732 missense probably benign 0.12
R7388:Cdk5rap1 UTSW 2 154360675 missense probably damaging 1.00
R7650:Cdk5rap1 UTSW 2 154354116 missense probably benign 0.01
R8424:Cdk5rap1 UTSW 2 154346012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCAAAGGACCAGTCGTTC -3'
(R):5'- TGTTTTCAGGGCCTAAAAGAAGTG -3'

Sequencing Primer
(F):5'- ACCAGTCGTTCTGCAAGGAG -3'
(R):5'- AGTGACACTTCTTGGTCAGAATG -3'
Posted On2021-04-30